Open Close
General Information
Symbol
Dmel\Anp-RA
Species
D. melanogaster
Annotation Symbol
CG1361-RA
FlyBase ID
FBtr0085611
Feature type
Associated gene
Evidence Rank
Length (nt)
272
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CATCAGTGTAAAATTCGGAAAACCCAGCGATCTAGTTATGAAATACTTTGTGGTCCTTGTCGTCCTGGCCCTCATTTTGG
          CCATCAGCGTGGGTCCTTCGGATGCAGTATTTATTGATATTCTTGACAAAGTGGAAAACGCAATACACAATGCTGCTCAA
          GTGGGAATTGGCTTTGCTAAGCCCTTTGAAAAATTGATCAATCCGAAGTAATTCTGCACTGCAATTTAATTAATGTATCG
          TTTAACGAAAATAAACACAAATTTTAAAATCT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0346141
          373
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0084976
          57
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0311969
          57
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          5' terminus supported by primer extension (FBrf0053874)

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG1361-RA
          Secondary FlyBase IDs
            References (2)