Open Close
General Information
Symbol
Dmel\CDase-RA
Species
D. melanogaster
Annotation Symbol
CG1471-RA
FlyBase ID
FBtr0085646
Feature type
Associated gene
Evidence Rank
Length (nt)
2639
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 42 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ACAGTCGAGTGCCAACTTGGGCGCAAAACAGGCGACGACCCAATCCCACGGCTCGGTTTCGTTTCGAGATAGTTTCGTTT
      TGGAGGGGAGCGGTTCGAAAAAAAATCAAAAAACAAACGGTCGCGTTCGTGGAAAGATAAATAAATCGAAAAATCAAGTG
      GGGGCCAGCATGTTTTGAAATCGGCCTTTGGCATCGACAAGCGGCAAACTGCAACTGCAAATGCTGCACATTATCCATTA
      ATTGGGCAGATAAGAAGCGTGTGATAAGCGCACAGCGAATATAACTACGGCAATTGAAGCCCCACCACGATTGAACAGTG
      AATATTTAAGTTAAGTGCTCCATTTAACAATGGCTAATAGCAAGATGGCCTTCTTGGCCTTTCTGGCCGTAAGTTTCCTG
      TGTGGATTGGTTAGTGCCACCTACAAAGTGGGCGTGGGCCGCGCGGATATCACAGGACCTCCAGTGGAGATCAATTTCAT
      GGGCTATGCCAACATCAAGCAAGTGGGTCGTGGCATCCACACCCGTGTCTTTGCCCGTGCCTTTGTGGTGGAGGATGAAA
      AGGGCAACCGAGTGGCCTTCGTGAGCGCAGATGCCGGAATGATGGGCTACGGATTGAAGAGGGAGGTGATAAAACGACTC
      CAGGCACGTTATGGCAACATCTACCACAATGATAATGTGGCCATCAGTGGCACCCACACGCACGGTGCTCCTGGCGGATT
      CCTGATGCATCTGCTCTATGACATCTCCATTCTGGGCTTTGTGCCTCAGACGTTTGAGGTGATGGCTCAGGGACTGTATC
      TGTGCATCAAAAGGGCGACGGACAACCTGGTGGATGGTCGCATCTTGCTGTCCAAAACTACTGTGCTAAATGTTAACATC
      AATCGTTCGCCCTCATCCTACTTGAGGAATCCCGCCGAGGAGCGTGCCCAATACGAGCACGATACGGATAAGACACTGAC
      CCAGCTGCGATTTGTCGACCTGGAAAACAACCTCCTGGGCGCTTTCAACTGGTATGCGGTGCATGCCACCTCCATGAACA
      ATACCAACAGACTGGTGACCAGCGACAATGTGGGTTATGCCGCCCTGCTCCTGGAAAAGGAGTACAATCCGAACAAGATG
      CCCGGAAAGGGCAAGTTCGTGGGTGCCTTCTGCTCATCCAACCTTGGCGATGTGTCCCCCAATATAATGGGTCCCAAGTG
      CTCGATCTCCGGCAATGAGTGTGATCTACTGACCTCCCGTTGTCCCACTGGCGAGGGAGATTGCTTTGCCTCCGGACCCG
      GTAAGGATATGTTCGAAAGCACCCAGATCTTGGGTCAACGTCTGGCGGATGCTGCTCTGGGACTGCTCAACGAACAGAGC
      CAGGAGTCCACGGCACGGGAGGTCACTGGAGATGTGAGGTTCATCCACCAGTTTGTGGACATGCCCAACTACAATGGCAG
      CACCTACAATCCGCTGAGCAGGAAGGTCGACAAGATCAGGGGATGTCAGCCGGCCATGGGCTATAGCTTTGCTGCTGGTA
      CCACCGATGGACCTGGAGCCTTCAGCTTCGAGCAGGGAACCACCACGGACAACCCCATGTGGAACTTTGTGCGCGACTTC
      ATCGCTGCTCCCACGCAGGAGGACATCAAGTGCCATGAGCCCAAGCCCATTCTTCTGGCCACCGGCAGGGCCACCTTTCC
      CTATGAGTGGCAGCCAAAGATTGTCTCGGATCAGCTACTAAAGATCGGCGATGTGATCATAGCCGCCGTGCCCTGCGAGT
      TCACCACAATGGCAGGACGTCGTCTGCGAAACCAGATTCGAGCAGCTGCCTCCGCCGTCGGAGGCATCGACACCGAGGTA
      ATCATCGCCGGACTGACCAACATATACACCAGCTACACGGTGACCCCGGAGGAGTACCAGGCGCAGCGTTACGAGGCCGC
      CTCCACGATCTTCGGTCCCCATACCCACTCCATTTACATGGACGTCTTCGAACGCCTGACCAAGGCCATGATGCGTAATG
      AGACCGTGGATGCGGGTCCAAGTCCGCCGTACATGAATGATGTGATGCTATCGCTGAACACCGGGGTTCTCTTCGACGGA
      CATCCCATAAACACCGACTTTGGCTACGTGAAGTCGCAGCCCAACAAGGAGTACGGCATCAACGAGACGGTGAAGGTCAC
      CTACATATCCGGAAATCCGCGTAACAACCTCTTCACCGAGAAAACCTACTTCACCATTGAGCGAAAGATCAACGAGGATC
      GCTGGAAGGTGGCCTATACGGATGCCAGCTGGGAGACCAAAATGGTCTGGCACCGAACCAATACGATCCTGGGCTTCAGC
      GAAATGGACATCTACTGGGACATCAGTCCGCAGACTCTTCCCGGGGAATATCGCATTCGCCATTCCGGGGAGTACAAGTA
      CATCCTGGGCGGAAAGTATCCCTACGAGGGACTCACGCATTCCTTCACCGTTAAGGAGGACTAGGATTAGATATCCGTGT
      GGAGTGATTTTATAAATATTCCTGGCCAGACAGTTGTAGGGCCCATCAAAAACAAAATCAACACTGAATCCATGTATTTA
      TTTACCATTTGTAAGTGACGAAGGAAAAGCTTTATTTTTGCAAACGCGAATAAAAAAGATGCCAAATTATGTTGAAACT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0085645
      2372
      FBtr0085647
      2744
      FBtr0085648
      2740
      FBtr0085649
      2875
      FBtr0331357
      2336
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0085008
      704
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0085007
      704
      FBpp0085009
      704
      FBpp0085010
      704
      FBpp0085011
      704
      FBpp0303775
      704
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CDase-RA
      CG1471-RA
      Secondary FlyBase IDs
        References (2)