Open Close
General Information
Symbol
Dmel\CDase-RD
Species
D. melanogaster
Annotation Symbol
CG1471-RD
FlyBase ID
FBtr0085648
Feature type
Associated gene
Evidence Rank
Length (nt)
2740
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 28 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACAGTCGAGTGCCAACTTGGGCGCAAAACAGGCGACGACCCAATCCCACGGCTCGGTTTCGTTTCGAGATAGTTTCGTTT
        TGGAGGGGAGCGGTTCGAAAAAAAATCAAAAAACAAACGGTCGCGTTCGTGGAAAGATAAATAAATCGAAAAATCAAGTG
        GGGGCCAGCATGTTTTGAAATCGGCCTTTGGCATCGACAAGCGGCAAACTGCAACTGCAAATGCTGCACATTATCCATTA
        ATTGGGCAGATAAGAAGCGTGTGATAAGCGCACAGCGAATATAACTACGGCAATTGAAGCCCCACCACGATTGAACAGTG
        AATGTGAGTGCTGGAGCGAATAAGCCAGGGTCAGGCTGCCCAAAAAAAAAAGGAGTTCACATTGCATAACCCTCAAAAAC
        AAGTACCAGCTTCCCGAAATCAGTATTTAAGTTAAGTGCTCCATTTAACAATGGCTAATAGCAAGATGGCCTTCTTGGCC
        TTTCTGGCCGTAAGTTTCCTGTGTGGATTGGTTAGTGCCACCTACAAAGTGGGCGTGGGCCGCGCGGATATCACAGGACC
        TCCAGTGGAGATCAATTTCATGGGCTATGCCAACATCAAGCAAGTGGGTCGTGGCATCCACACCCGTGTCTTTGCCCGTG
        CCTTTGTGGTGGAGGATGAAAAGGGCAACCGAGTGGCCTTCGTGAGCGCAGATGCCGGAATGATGGGCTACGGATTGAAG
        AGGGAGGTGATAAAACGACTCCAGGCACGTTATGGCAACATCTACCACAATGATAATGTGGCCATCAGTGGCACCCACAC
        GCACGGTGCTCCTGGCGGATTCCTGATGCATCTGCTCTATGACATCTCCATTCTGGGCTTTGTGCCTCAGACGTTTGAGG
        TGATGGCTCAGGGACTGTATCTGTGCATCAAAAGGGCGACGGACAACCTGGTGGATGGTCGCATCTTGCTGTCCAAAACT
        ACTGTGCTAAATGTTAACATCAATCGTTCGCCCTCATCCTACTTGAGGAATCCCGCCGAGGAGCGTGCCCAATACGAGCA
        CGATACGGATAAGACACTGACCCAGCTGCGATTTGTCGACCTGGAAAACAACCTCCTGGGCGCTTTCAACTGGTATGCGG
        TGCATGCCACCTCCATGAACAATACCAACAGACTGGTGACCAGCGACAATGTGGGTTATGCCGCCCTGCTCCTGGAAAAG
        GAGTACAATCCGAACAAGATGCCCGGAAAGGGCAAGTTCGTGGGTGCCTTCTGCTCATCCAACCTTGGCGATGTGTCCCC
        CAATATAATGGGTCCCAAGTGCTCGATCTCCGGCAATGAGTGTGATCTACTGACCTCCCGTTGTCCCACTGGCGAGGGAG
        ATTGCTTTGCCTCCGGACCCGGTAAGGATATGTTCGAAAGCACCCAGATCTTGGGTCAACGTCTGGCGGATGCTGCTCTG
        GGACTGCTCAACGAACAGAGCCAGGAGTCCACGGCACGGGAGGTCACTGGAGATGTGAGGTTCATCCACCAGTTTGTGGA
        CATGCCCAACTACAATGGCAGCACCTACAATCCGCTGAGCAGGAAGGTCGACAAGATCAGGGGATGTCAGCCGGCCATGG
        GCTATAGCTTTGCTGCTGGTACCACCGATGGACCTGGAGCCTTCAGCTTCGAGCAGGGAACCACCACGGACAACCCCATG
        TGGAACTTTGTGCGCGACTTCATCGCTGCTCCCACGCAGGAGGACATCAAGTGCCATGAGCCCAAGCCCATTCTTCTGGC
        CACCGGCAGGGCCACCTTTCCCTATGAGTGGCAGCCAAAGATTGTCTCGGATCAGCTACTAAAGATCGGCGATGTGATCA
        TAGCCGCCGTGCCCTGCGAGTTCACCACAATGGCAGGACGTCGTCTGCGAAACCAGATTCGAGCAGCTGCCTCCGCCGTC
        GGAGGCATCGACACCGAGGTAATCATCGCCGGACTGACCAACATATACACCAGCTACACGGTGACCCCGGAGGAGTACCA
        GGCGCAGCGTTACGAGGCCGCCTCCACGATCTTCGGTCCCCATACCCACTCCATTTACATGGACGTCTTCGAACGCCTGA
        CCAAGGCCATGATGCGTAATGAGACCGTGGATGCGGGTCCAAGTCCGCCGTACATGAATGATGTGATGCTATCGCTGAAC
        ACCGGGGTTCTCTTCGACGGACATCCCATAAACACCGACTTTGGCTACGTGAAGTCGCAGCCCAACAAGGAGTACGGCAT
        CAACGAGACGGTGAAGGTCACCTACATATCCGGAAATCCGCGTAACAACCTCTTCACCGAGAAAACCTACTTCACCATTG
        AGCGAAAGATCAACGAGGATCGCTGGAAGGTGGCCTATACGGATGCCAGCTGGGAGACCAAAATGGTCTGGCACCGAACC
        AATACGATCCTGGGCTTCAGCGAAATGGACATCTACTGGGACATCAGTCCGCAGACTCTTCCCGGGGAATATCGCATTCG
        CCATTCCGGGGAGTACAAGTACATCCTGGGCGGAAAGTATCCCTACGAGGGACTCACGCATTCCTTCACCGTTAAGGAGG
        ACTAGGATTAGATATCCGTGTGGAGTGATTTTATAAATATTCCTGGCCAGACAGTTGTAGGGCCCATCAAAAACAAAATC
        AACACTGAATCCATGTATTTATTTACCATTTGTAAGTGACGAAGGAAAAGCTTTATTTTTGCAAACGCGAATAAAAAAGA
        TGCCAAATTATGTTGAAACT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0085646
        2639
        FBtr0085645
        2372
        FBtr0085647
        2744
        FBtr0085649
        2875
        FBtr0331357
        2336
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0085010
        704
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085008
        704
        FBpp0085007
        704
        FBpp0085009
        704
        FBpp0085011
        704
        FBpp0303775
        704
        Comments

        GC splice donor site postulated.

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CDase-RD
        CG1471-RD
        Secondary FlyBase IDs
          References (2)