Open Close
General Information
Symbol
Dmel\CG1607-RB
Species
D. melanogaster
Annotation Symbol
CG1607-RB
FlyBase ID
FBtr0085786
Feature type
Associated gene
Evidence Rank
Length (nt)
2956
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 84 )
Sequence
CCAGTCTGCCTTAGCCGCTGTTTGCGTACGGTTCTGCTTCTCCGGCGGAACTTGTTAGTGAAAGCCTATTAGTTGGCGGG
AAAGCGTTCGGATCTCTTAAGAATACATTTAAAGTCGGAACCCCAGTGCTGACAGCATGGAAACGGAGTCTCTGAACCGC
AAGAACTCCTCGCGGAAGAGTTCAATCGTGAATGGGAATGGAGATGCCTCTGCCAAGTTGACCAACGGCGATGGAGATGG
AGGCGGAGACGGAGGCGGAGAGGTGACTCTGAAGGCCAAGATGAGCCTGCTCAATGGATGCACCGTCATAGTGGGCTCCA
TCATCGGATCGGGCATCTTTGTATCGCCCACGGGAGTGCTGATGTACACGGGCAGTGTCAACCTGGCCCTCATCGTTTGG
GTCATTTCCGGCCTTTTCTCGATGGTGGGTGCCTACTGCTATGCGGAGTTGGGAACGATGATCACCAAGTCGGGTGCTGA
TTACGCATACATCATGGAGACTTTCGGACCCTTCATGGCCTTCATCCGACTCTGGATCGAGTGCATGATCGTGCGACCCT
GCTCCCAGGCCATCGTAGCCCTCACCTTCAGTACCTACGTCCTGAAGCCCTTCTTCCCGGAGTGCACTCCTCCGGAGGAC
TCGGCCCGCCTGCTAGCCGTCTGTTGCATCCTTGTGCTAACCCTAATCAACTGCTGGGACGTAAAATGGGCGACCGCTGT
GCAGGATATCTTTACATATGCGAAACTGCTGGCCCTGTTTATCATCATTGCCACTGGCGTTTACCAACTTTACCTCGGCA
ACACGCAATACTTTACGTTTGAGAATACGGACACGAAAGTGACCTCCATCGCGCTGTCCTTCTACTCCGGTCTGTTTGCC
TACAACGGATGGAATTACTTGAACTTCATCATTGAGGAGCTGAAGGATCCCGTCAAGAATCTGCCCCGCGCCATCGCCAT
CAGTTGCACCCTGGTGACCATTGTCTATGTCATGGCGAATGTATCCTTCTACACCATCCTGTCGCCGGATGAGGTCATGG
GCTCCTCGGCCGTGGCGGTGACCTATGCGGAGCGGGCCTTCGGCATGCTGGCCTGGACCATTCCAGTTTTTGTGGCCTTG
TCTACGTTTGGAGCAGTGAACGGCATTCTGCTGACCTCCTCCCGACTCTTCTACGCCGGAGCCAACAACGGCCAGATGCC
CGAGATCCTCACCATGATCCAGATCCAGAGATTCACACCCACTCCCGCGGTTTTGGCCATGGCGCTTCTATCGATGTTGT
ACCTCACCGTTTCGGACATCTTTGCTCTGATTAACTACGTCGGCTTTGCCACTTGGTTGAGTATCGGTGTGGCTGTATTG
TGCCTGCCTTGGCTGAGATGGGCCCAACCCAATCTGCCACGTCCCATCCGAGTGCCCATGGTGTTCCCCATTGTCTACCT
TATTGCCACCATATTCGTGACCGTGGTGCCCATGTACGCCAGTCCGGTGGAGACTGGATACGGCATCCTTATGATCCTGT
CCAGTATACCCGTCTACCTGGTGTTCATCGCCTGGAAGAACAAGCCCATTTGGTTCCAGAAGACTATGGGCGGACTGACA
CAAGTTCTGCAGAAACTGATGATGGTTGTGCGTCCAAAAGCGGCGTCAAAGTAAGCCTCACACGATTCCTACAGAAAATG
CTCATGGTACTCGGAAAGCAGACGAAACCAGCTCAGGTGTAAAGGTAAAGAACGTTCTTCGGGGAAAATAGCGGAGATAA
TATTTCAAGTTAGCCAAGAGCAGAGAAAAGCATTTAAAAGCACACACTTTGATTGCAAGATGCATTATATAGACAACGTA
AACGCTTTTGTGTAGCCAACCAATGATATACATACGAAATACACAACAACTTCTGCCAGCTCCTGGGCGACTATACGATA
TATACCATATATATATTTTTATATACACATGTAAGTCTTAAGTTGAAGCAAGGCCCAGGATTACGAGGAAGTTCCCAACA
GAGGTCTGGATCCAAATTTAATATAAAGACTGTGGAAAACTACAAGGAATCAAGGAATCAAGGTGTCCAGAGCTGTCCGT
AAATTGGGTTCGAATTTGGATTTGGCATTTTTTTAGCAGAGCTGTGCAAGCAGAACGAGTCTTTTAGGATTTTCAAGTAT
TCTCGAAAGGTGGTTATGCAAACTGTGAAGCCCCGATAAAAGCTATTGTTTATTATTAACTGCATTTGAAAACTAATTTT
TTGAGAAATTTAGTAACCATGCTCTAGGCTTGGCTTGATCTAGAAAGCTAGAAGAACGCTTGAACATACTCATCGGAAGG
ATCTACAAAGCCCATCTTAGTACCCACAAATGAACATGAACATTTTAGAGCACGATTGATTACTTTTTATTGATTTAAAC
GAATCTAGCTTAAGTGACACCGCAATTAAATTTCACTTGTCTAAGTTAATACATACATTTAGGTTGCTCAGTTTAGGTTT
CACATGTGCATCGTAGAGGGTGCTGCCTGTACAAAGCCCAAGCCAATATACAAAACCATCGCATAATGCACATATCCAAC
AAGAGAAACGATTAAAGTTGTTGAACGAGAACAGGAACATTGCCAACATACATATTAATATACTGAAAATAACACTATAT
GCAAATTGTTGTCTAATTACGAATCCAATCGTATCGAATCGAATTGATCTAGCATTGATTTAAACTTTCATTAGTTGTTG
TTGCTTTGAGTGTTCGTCACTTAGTGTTATTCATATGAAACTATTATTGCCTATTTAGCATTCAACTAATTAACTGTTAC
ACATTAAATATGGAGCCGCAGCTGGGGAATCAGTTTAACTACTATGAAACATATTGTTGACAATAATATTGTATTTATAT
ATAAATGTATATTATATTATATGATGTATACCCTACAACCTCTGTATTTCTGGAAATAAGAACGATAACGAAATCT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0085785
3082
FBtr0334549
2894
FBtr0334550
3020
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0085147
505
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0085146
505
FBpp0306616
507
FBpp0306617
507
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG1607-RB
Secondary FlyBase IDs
    References (2)