Open Close
General Information
Symbol
Dmel\Gprk2-RA
Species
D. melanogaster
Annotation Symbol
CG17998-RA
FlyBase ID
FBtr0085788
Feature type
Associated gene
Evidence Rank
Length (nt)
4690
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 59 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTTCACTAACTCAACGACGGTCTTACAGAAGACTCCAATATTTTTCGAGCAGGCAATTCGCGGATCCATCGTTAATTTTG
        GGCACTTGCAGAAAGCCCAGTTGCGAACGTCGTCGTGTGTCGTCTTAGAAAAGCCACTCCTCCAACCGGAAAACCGCAAG
        AGCGTCGAGCCCTTGTTTTGCGAGCCTTTTCGAAAAAAGCTGGGAATTTCACGCCGTATTTTTCGTATCTTTTCCGTCAA
        CGAAACGCCGCGTGTGTCGTAGTGTGCGTGTGTGTGTTCTGTGTGCCCGCCCATCTGTGCATGTGTGAGAGCGCGCCTGT
        GTGTGTGAATTTTGGTGAGAGCCGCAACAACAACCGAAAAGAAAACCAAAATCGACAAATGCGGTCAAATTGAAAAGAAA
        AACAAAAAATCAAAGAGTATTCTTGCGCAAAGCCAAAAGGCAAAGTCAAAAAAGAGCGCAAAGCCAAAAAAACGCAGATT
        TCCCAACGAAAAGGCCGGAAAATTGCCCACTAGGCGTGTCGCTGCTTCTTCTTGTTCTTTCAAATTGTTTATGCTGCAAT
        TGCAGTGGTGTGCGAAAGGAGTGGTAGAGAGAGAGAGAAGGAAAAGCGTCTTATCAACGCCCGCTTTCTTATCAGAACCC
        ACACATTTGTTGCGAAAATTCCAACCAGCCGAAACTCACAGTGAAGCTTTAAATAGCACATCAAACAAACAGTTGCCCAG
        CTATCAGCGAATCGGTCAATTTCATTTGGAGAAGCCAAAGATTGAGGAAATCCATTGACCGACGGTTTTACAGCATTCAA
        TCAAGCGCAAATTGGCTCAACTTGCAAAAAGGGCACATTTTCGGCCTTGCAAATTCCAATCTTGAAACTAAATGACGCCT
        GTGTCTGAAACCGAGACCCTGCTGCCAAATACCGCAACGCTGGACGCCAGACGACGGCCACAAATTAGCCAGCCAGCCGT
        AGATTTGCAAGTCTAAGGAGTCGCCCTGCCCACCAGAACGCAGAAGGGGATCCCTGTTCAAAGGAGCCAGCGAAGGCCAC
        ACACAGGAGAAAGATCAAAAGGAGCACCAGCCAGTGTGACTGCGACTATTTTTCGGGAGCGCCAAAGGATTCATTAAAAA
        ACCGCCAACCTGGAACTAATGGAATTAGAGAATATTGTGGCCAATACGGTCTACTTGAAAGCGAGAGAAGGTGGTTCCGA
        CAGCAACAAGGGAAAGAGCAAAAAATGGCGCAAAATATTGCAATTCCCACACATATCGCAATGCATCAACCTGAAAGACA
        AATTAGATATAAGCTATGGCTACGTGATAGATCAGCAACCCATTGGTCGTGAGCTCTTCCGTCTGTTTTGCGAGAACAAA
        CGGCCCGTCTACTTTCGCTACATCACCTTCCTGGATGAGGTGGTCAAATACGAGATCGAGTACATCTCGAACCGCATATT
        CATTGGCCATGACATCGGCCGTCGCTTCTTGGATGTCGAGGCACAGCTGGAGCTGCGCAACGGCAGCGGGGGCGACGCCT
        TGGACGCCGAGACGCAGGAGGAGCTGCTGCTCAACAGCAGCAATGCCAATCCAACTGAAACAGCTGAGACTGAACACTGC
        AACAATACCACCGCCAACAACTGCAACAACATCAACAACAGCAACAACTCGCAGCACAGCAGCGACATCAATCACAAGAA
        GCTGGACACGCGCAATCACAACGGCGACGACGCCACTGGGAACGGGAGCAGCCACCAGGACGACGGGGACGAGAGCGTCA
        AGTGCCAGGAGGGCCATGACGATGCGGAAAAGGGTGGTGGCGGAGAGGGAGGCGGCGGCGGAAAGTGTGTCCCCGTGGGC
        GGGTATCCTGACGAACTCGTGTTGGACGTGCTTAACGATGATCTCATTGCGCAAGTGCGTAACAAACTCAACAGCGGCGG
        CAAGGACATCTTTGCCCAGTGTGTGAACGCGGTTAAGGCGTTCCTGGCCGGCGAACCGTTCCGGGAGTTTGAGAGCTCTA
        TGTATTTTCACCGATACTTGCAATGGAAGTGGCTTGAGGCGCAGCCCATCACCTACAAAACGTTTCGCATGTACCGGGTG
        CTCGGAAAGGGCGGCTTCGGCGAGGTGTGCGCCTGTCAGGTGCGGGCCACTGGGAAAATGTACGCGTGCAAAAAGCTGGA
        GAAAAAGCGCATCAAGAAGCGCAAGGGCGAGTCGATGGTGTTAATCGAGAAGCAGATACTGCAGAAAATCAACTCGCCGT
        TCGTGGTCAATCTGGCCTACGCGTACGAGACAAAGGACGCCCTCTGCCTGGTGCTGACCATAATGAATGGCGGCGATTTG
        AAATTCCACATTTACAACATGGGCGGCGAACCAGGCTTTGAACTGGAGCGTGCCCGCTTCTATGCCGCCGAGGTGGCCTG
        TGGACTGCAGCACCTGCACAAGCAGGGCATCGTCTACCGGGATTGCAAGCCGGAAAACATCCTCCTTGACGATCACGGCC
        ATGTGCGCATTTCCGACCTGGGACTGGCCGTCGAGATACCGGAGGGCGAGATGGTGCGCGGCCGGGTGGGCACAGTGGGC
        TACATGGCCCCCGAGGTCATCGACAACGAGAAGTACGCCTTCTCCCCGGACTGGTTCAGCTTCGGCTGCCTGCTGTACGA
        GATGATCGAGGGCCAAGCGCCGTTCCGGATGCGCAAGGAGAAGGTCAAGCGCGAGGAGGTGGACAGGCGCGTTAAGGAGG
        ACCCCGAAAAGTATTCAAGCAAGTTTAATGATGAAGCCAAATCAATGTGCCAACAGCTGTTAGCTAAATCGATAAAGCAG
        CGCCTGGGCTGCCGCAACGGTCGCATGGGCGGGCAGGATGTGATGGCCCACCCGTTTTTCCACTCCACCCAGCTCAATTG
        GCGTCGCCTGGAGGCTGGTATGCTGGAGCCACCCTTTGTGCCAGACCCGCACGCCGTTTACGCCAAAGATGTGCTCGATA
        TTGAACAGTTCTCTACGGTGAAGGGCGTCAATATCGACGAATCCGACACGAATTTCTATACGAAATTCAACACAGGCTCC
        GTGTCCATTTCCTGGCAGAACGAGATGATGGAGACCGAGTGCTTTCGGGAACTGAATGTTTTTGGTCCCGAGGAGTGTCC
        CACGCCAGATTTGCAAATTAATGCAGCGCCCGAACCAGACAAGGCGGGCTGTTTCCCCTTTCGCCGGAAGAAGAAGCAGC
        CGGCTCGCACTCAGCCCATACCCATTCCGGAGCATCTGTTAACCACTAGTCACAGCGTGTCCTCCACGACGGTCGAAAGC
        TGATAGCAGAGATCAGTCGAGGATGCCTTTAAGCGGACGCCTGACGTAGACGTCGACACATAGCACAAATTGCGCACAGT
        TACCCCGGATCGGAAGAGTTCAGCAGGAGCATAATAACTTTAGAGCACAACCTAATTATAAAACCGAAACTACATCGGTT
        TATCCTTCAGTTGACGCGCAAGAAGCATTTTTGAAATTGTACTTTTACATCAAATTTTCTAATGAAAGTTGTTCAAGCTG
        ATTTCGACACACAATATATATTTATAAATGTTTCAAAAAGACTCCTAACCGAAACAACACACACATTGAGCACACATTAG
        AGAGTTAATTAATTGTAATTGTGGTAACAAGAATACCACTTACTATACCACTTTGAGAGCTAAGGCCGTCAGTTTGTCAC
        AGCACCCAAAAATAATGTTACTTAAATACGAGCGCTATACAATATACACGCGTCGCCAGAAGCGGGACAACGGCGGATGG
        GCAGGAACAGCACTACGTAGACGGCTGAGTAATATGTAATTTTTGTATAGTAGTTTGTGATCGACGGGACAGCGTTGGAC
        GATAGATGTTCTAGTTAGCATTTGTAAGTTAAGAAAATGACATGAATACTCGAAAACTTGAATGCATTTTTAACAAATAC
        TTAACACATGCTACTACGTTGTACATGCGTAGATGCGATACAAGCGTGCAACCTAATCAGATGTAAATGTAAAATCTTTA
        ATTATTTATACGACTCCTAAGTTTTATTGCCGCACTCTTTTGCTAAGCTTTTCATATCGTTCTTTTACTTTTTCTGTTGC
        CTAAGTTTAAGTTGCCGAAGGTTCCCATGGAAGAACGTTATTACTGATATTTGTTTCGTCACGTAATTAAATGAACAGCA
        GCAGCAGTTATGCTAACTAATGCAAATTCATTGAGATATCGATGTCAGCTAGCGTCTAAGTTTTGTGTAATAGTAGCGTA
        GGCATTTTGTAATTAGCAATTAGCAACAAAGAAAGAAACAAAAGTAAACCAATTGGAGAATTTATTATGTTAGTATGAAA
        ATTAATTATGATTATCGAACCGGTTGGCTGGCAGCATGGAACGCGCCAGCTGAACGTCTTAGTTTCAATTCACTTGATTT
        AGGCACAACTAGTAAATTGTAAGGCATATAATGAACAACTACTAACAGCACAACCAACCAGCATTCAAAACAGCAAACGC
        CATCAGCATCAGCTCCAAATCCAATTTAGCACCACGACTACATAAAGTAAACCAAACTGAGCAAGCGCCGAAATATTTAT
        CTCTAGCAATTAAAGGCATATTTATAGAGCATCGTAAATACCAGATATACATACATAAATAAATCTATTCTGTAAGCGAA
        ATAATACAAAATACAACCGAAAAGTCAAGAGATGGACACTCAAAAACAAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0334555
        3545
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0085149
        714
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0306622
        714
        Comments
        Extended 3' UTR based on RNA-Seq and/or EST data.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG17998-RA
        Gprk2-RA
        Secondary FlyBase IDs
        • FBtr0007022
        References (3)