Transcript Dmel\His4:CG31611-RA

General Information
Symbol	Dmel\His4:CG31611-RA	Species	D. melanogaster
Annotation Symbol	CG31611-RA	FlyBase ID	FBtr0085926
Feature type	mRNA	Associated gene	Dmel\His4:CG31611

Evidence Rank	Weakly Supported	Length (nt)	413
Evidence Score	3

Map ( GBrowse )
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
cDNA Clones Consistent with the Transcript ( 5 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the annotated transcript, internally consistent
End(s) extend beyond the annotated transcript, internally consistent
cDNA Clones, End Sequence Only (ESTs)
Contained within the annotated transcript, internally consistent	Dmel_dig_010567_0685_1044 Dmel_dig_011537_0695_3224 Dmel_dig_016609_0677_1943 Dmel_dig_017963_0589_0937
End(s) extend beyond the annotated transcript, internally consistent	LD02669
Sequence
	TTAGTTCTTTAGTGACTTTCGTGCTGTGCGTGTATAATAGTATAGAACAG TGAAAAATGACTGGTCGTGGTAAAGGAGGCAAAGGCTTGGGAAAGGGTGG CGCCAAGCGTCATCGCAAAGTGCTGCGTGATAACATCCAAGGTATCACGA AGCCTGCTATCCGCCGTTTGGCCCGTCGAGGCGGTGTGAAGCGCATATCT GGACTCATATACGAGGAAACGCGTGGCGTTCTGAAGGTTTTCTTGGAGAA CGTAATTCGTGATGCCGTGACCTACACGGAACACGCCAAGAGGAAGACAG TTACAGCCATGGATGTTGTGTACGCTCTGAAGAGGCAAGGCCGCACCCTC TACGGATTTGGCGGTTAAAAAGTGTACATCCTGTGTACCCCTATTAAGCA ATCGGTCCTTTTC
Other Products of this Gene
Polypeptides
Derived from THIS transcript	Name FlyBase ID Length (aa) His4:CG31611-PA FBpp0085280 103
External Crossreferences
	RefSeq - An integrated, non-redundant set of sequences • NM_165383
Synonyms
	CG31611-RA His4:CG31611-RA
References ( 2 )
FlyBase analysis	FlyBase Genome Annotators, 2004, Changes affecting gene model number or type in release 3.2 of the annotated D.melanogaster genome. Changes affecting gene model number or type in release 3.2 of the annotated D.melanogaster genome. [FBrf0166453] FlyBase, 1996-, FlyBase inference based on genome sequence analysis. FlyBase inference based on genome sequence analysis. [FBrf0104946]