Open Close
General Information
Symbol
Dmel\Fis1-RA
Species
D. melanogaster
Annotation Symbol
CG17510-RA
FlyBase ID
FBtr0086073
Feature type
Associated gene
Evidence Rank
Length (nt)
630
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 9 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATTTTTAGAATGAACGGCTACTCTTGGCGTTAAATTCTCTGTATATAATTTTTGTATTTGCTAACAACATTTGCCAAACA
      ATGGAGGATCTTTTAAACGAAGTTGTACCACAAGAAGATTTAGAAGTACGCATTCTGTCTGGTCCGAAGTCGGTACACAA
      ATGACGTTAGAAAGGGAATTATGATTTTGGAGGAACTGGCTCGTACGCATCCAGATGGAAGGCGTGACTATATATATTAT
      CTTGCGTTTGGTAATGCTCGTATCAAGGAGTATACGTCTGGCTTAAAATACTGCCGAGCTTTTCTTGACATCGAGTCAAA
      TGATCAAGTTCGCTCCCTAGAGGAATATATTAAAAAAGAAATCGATAAGGAAGTGGCAAAGGGTATGGTGGTTGCAGGCG
      GAGCAGCTTTAGTACTTGGCGGAATATTAGGACTTGGCATTGCTATGGCTAGAAATAAACAAAAACGGGAGAAATAGTAA
      CGTCACCACTATTTAAGGAAAATAAAACATCGAAAGGTGCACATCAAGATGTTATGAAGTTTAATACTTGAAATATGTTA
      ATTTACTACATCAACATTCTAATTAATCTTTATGTACGGTTAAATCAATAAATTATCCAATTGTTGCTTG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0273208
      698
      FBtr0273209
      560
      FBtr0273210
      628
      FBtr0273211
      704
      FBtr0345012
      557
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0085409
      98
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0271716
      154
      FBpp0271717
      92
      FBpp0271718
      148
      FBpp0271719
      92
      FBpp0311263
      98
      Comments

      Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG17510-RA
      Fis1-RA
      Secondary FlyBase IDs
        References (0)