Open Close
General Information
Symbol
Dmel\Vha16-1-RA
Species
D. melanogaster
Annotation Symbol
CG3161-RA
FlyBase ID
FBtr0086150
Feature type
Associated gene
Evidence Rank
Length (nt)
2833
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 444 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        Sequence
        GTGTTCAGTATCCGATCCGCGCTTTTAAGCAGCAGCCAGCAGTAACCCGAAGAGGCCACAGAGCAGCGAATTGCTTTTAA
        TTAGATTTCTAATCACCCTAAAAAACACACAACAAACAAAGCAAAATGTCTTCTGAAGTGAGCAGCGACAACCCCATCTA
        TGGCCCCTTCTTCGGAGTTATGGGAGCCGCCTCCGCCATCATCTTCTCGGCCCTGGGCGCTGCTTATGGCACTGCTAAGT
        CTGGTACCGGTATTGCTGCCATGTCAGTGATGCGGCCTGAACTGATCATGAAATCCATCATTCCTGTGGTCATGGCGGGT
        ATCATTGCCATTTACGGTCTGGTGGTGGCTGTGCTTATTGCCGGCGCGCTGGAAGAGCCATCAAAGTACTCACTATACAG
        GGGCTTCATTCACTTGGGAGCCGGTCTGGCGGTGGGCTTCTCTGGTCTGGCAGCTGGTTTTGCGATCGGCATCGTGGGAG
        ACGCCGGTGTCCGTGGCACAGCACAGCAGCCTAGACTGTTCGTGGGCATGATCCTGATTCTCATCTTCGCCGAAGTGTTG
        GGTCTCTACGGCTTGATTGTGGCCATTTACCTGTACACGAAATAAATCAATCAATGCAAACACACAACAACAACAGATAG
        ACAAACGGCGCCCAGCGGTCAACAGCAGCCACATCAACATCAGCAGCAGCTTCAAGAGGAGCAGGTAAAATTGTGTCAAG
        CCAATGAGCAACGTGCAACATGCAACTTCCAACAAGCAAAAACCACAACAGTGCGTGTGCGGTGCAAGCCCGGCGTGGAC
        CGTTTGTACATAGGGAGAACAACCAAAACCAGTCCTGCCGGACTGCAGGATCTCCGCCACGCACTGCCCATTGGTGGCCG
        CCGATTTGCACCTGTTGTTCAGTTTACCTCGATTCGCTGGCGCGTGGTTTAGCTTAGTTATTTTCCGTTCAAAATCAGTC
        TTAAACACGAGGAAAACAATTTGCAATTAAGTTCATAAAGATGTAATAATTATGATTTTTGCTATATCAAGAAATCCTGC
        TCTTTTACTTTTTATTTTGCGCTCCACAATTTTGTGTGCTCTTTGTTATTTGTTTTTTCCATTATTATTATTAAATAATG
        TTTAGTGTATATGTAAAGTTCGTTAAACAAAAAGAAAAAATTGTAAAGAAATCAACAACCAACAATTGTCAGAAGAAACT
        TTGTACATTTGCATTGAGCCTGACGCGGCTGCAACCAATTCAGATCAACAAATTTAGCGAAAGGGCCAAAACAACAAACA
        AACAAGCAGCAACCACAACATCAATGCTACCGCCCGATGTCATCCGGTGCGGCAACGTACCGCTCTTGTCCGATTGCCGC
        TGTTTGGGCGCGCCCCGCCCCCTTCTTTGGTGGTGGGGGTGGAAGCCCAGTACAGTGGTGCCTCTGGATTTCGGACGGCA
        AGCGGACGCTTGGCAATACTTTATCGTCAACTGCGGAAACCAACTACATGCAATCATTCACACACACACACACAAAACCA
        ACACACACACACACACATACAAAATGTAACTAAGTCCTACGTTTATTTTTAATTATTGTTCAATTCTAAGAATAATATAT
        TAAAAATTAATAATAATAAATTATATATATAATTATGATTTTTTGTGATAAGAACAGATGGTAATGCAAACAATTACGGT
        ATTGATATACATAATATATACAGAATATATATATATATATAAACAAGAACAAGAAATCATAAACAATTATACATATTAAC
        ACGAGAAAGTTGTTATAAAACGTACGAAACAATACAAATCATGTGAATGAATGTAATGCGACAAACTAAAAAATACTGCA
        AATCAACAACCACAACACACACTTTTTCCGCTGTTATTGTATAGTAAAGAAAATATTATATATATAAATATATATTATGT
        ATAAAATATTAACAAGAAATTGTAGTAGCAAAATTATAAACCAACAAACAAGAATACCCACAACAAAAGTCGTGCAAGCA
        GAACCCAAAAACCGTAGACGAATGTTGCAAATGAAACTCATACCAACAACAACCACATTAGCAACACGAAATCTACCAGA
        AAAATCCAACAAAAAAAATTGTAAAATCCCAACAAATTAGAAGTTATAAGAAGCTACTTCGGAACCGAACCCAACAACAC
        CCGATCAACATGTATAGTAGTGGCATTAGGCAAATAACAATTAATTTGTAGGAGAGCCACGCAAGCCGAACGACCCGGTC
        CCGAGAAGGATGCACATTCCACCGCCCGTTGGACGCCGATGCATTCGTGATGCTGAGAATGCGGAGGAGCTCAACCTGTG
        CGGAGGCGCTGAATTCCCGGGACCCGAATCGCTCTGCTTGCGCACACCTCCCGATCCCCACAAGAAAGCGACCACAACAG
        AAATGCACAAAACACACCTGCAATAAACCACTTGTGCTCACAATCAATCAGCAATTGTATATAAGCATGTGACGTTGCCT
        GTCAATCACAGATTCCCCCATCCGACACCGAATCATGATGCAGCGTCAGTGTTACGTTCCCATCGGAAAACGGTGGGGGA
        AACTAATTAACTCGATTGCTAGCTTAAGGAACTCACGAAGCAAGTGTTGAATAGTCCGTTTATTATTGTTACGCGTACCC
        CCAACAATTGTGTCACGAATTCATATTGTTATTTGTTTAAGTTGCATGCACCCCACAACATAGACCTACCTATACATGTA
        TCCAATGGTGCGGTTTTAGAAACTGTAACTGTGTATTCGAAACAACTTATAAAGCAAGTAAACAACCATCAACAACAGAC
        ATTGTATGAAATAAATTGTAATTTCTAATTTCC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0086151
        2798
        FBtr0086152
        2981
        FBtr0086153
        2816
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0085483
        159
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085484
        159
        FBpp0085485
        159
        FBpp0085486
        159
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        Vha16-1-RA
        Vha16-RA
        Secondary FlyBase IDs
          References (2)