Open Close
General Information
Symbol
Dmel\CG11007-RA
Species
D. melanogaster
Annotation Symbol
CG11007-RA
FlyBase ID
FBtr0086464
Feature type
Associated gene
Evidence Rank
Length (nt)
1201
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 45 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TCTAGTCAACGGCGAGGCTAAAATTAACAATTGGCTGTCAAAAGCAAGAAAAGAAAAACTCGGGAAATTGTTAATTAAAA
      TCGTGACCCAGATCAGCGCATTCAGCCCCCGGACGCAGAGATGACGTGGAAGAAGCAGATGGCTCTGCTGGCCAAGCCAT
      ACTACTGGGTTAACATACTCCTGGCCATATCGTACCTTTTGGCCAAAAAGACGCAGTTCATCTGCACCCGCCTATTTATT
      CTCGCCGGAGAGGATGAAGCATGCGACCTGGACAGTCGTGAGGTGGAAATCTTGTTCTTCCTGCTAATCGTGGTGATGAT
      ACGGTCACGCAAAACGGGCAGTGTCACCATGATTAACTACTTGGCCTCGTCGTTCCTCTACACCAAAGTGGCCAACGCCA
      TTTTGTGGGCCTACGCGGACTTCCGCTACGGCCTGGGCTTTCTGCTTCTATGCGTCCTGGTGGGCATGGTGCTGCCGGAG
      CCCTCGTATCGCGGACCCGAGCACATCACCTACTTCCGCAACGCACAGGTCTTCGAGGAGGAATTGGCCAGGGACAAGCG
      AACCAGCTGGCTGATCTGCTTCTACACGGTGTGGAATCCCAGCTGCGTGAACTTCGCCCCCGTTTTTGCTGAGCTCTCCG
      CCGAGTACAACACGGACCACCTGAAGTTCGGCAAGATTGACATTGGACGCTTTCCGGACGTGGCCCAAAAGTATCGCATC
      TCGGACAGCAGCTTCTCCCGACAGCTACCAACTGTGATCCTGTTCCAACAGGGCAAGGAGACGGACCGCAGGCCCTGCGT
      CGATTCCAAGGGTAAACTGCAAAAGTTCTTCTTCTCCAGCGACAATGTGCGCGCCACCTTTGGCCTTAACCAGCTGTACA
      AGGAGGCCATCGAACGACTACCCATTGCGCCCAAGGAGGCCAAGAAGGTCCAGTAGGCTGTCCTGTCCACCACTGGTGCC
      ATCTCATTTCTGCGTGCACGTGCTAATAACTGTTATTCGTTTAGTTCATAGTTTATTTTAACTTATTGAGGAGCTGCCAC
      CGCCAAAGACACGTACAATTGCACTAATATTTGCATTCTAAACTCAGACGTGCTCTCGTCGCGATGCCATTGTAGAAAAT
      ATTTGTATGATCTTGCATTTGCATAAATTGTAGCTAATCACCAGGTACCAAATATATTTAAAAATGTGAAATGAGTCAAC
      G
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0345929
      1527
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0085660
      271
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0311843
      271
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG11007-RA
      Secondary FlyBase IDs
        References (2)