Open Close
General Information
Symbol
Dmel\CG15126-RA
Species
D. melanogaster
Annotation Symbol
CG15126-RA
FlyBase ID
FBtr0086475
Feature type
Associated gene
Evidence Rank
Length (nt)
281
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTGGACCCAACCGCACGGTTTTCAAAGTTTGCAAAAATATCTGAATAATGCCACCACCACACGGAGGACCCGGAGGCCAT
          GGACATGGAGGACCGCATCATGGCGGACCCCCGCATCATGGAGGCCACCATGGACCGCCACATCACCATGGACCGCCCCA
          TCATCACCACGGACCTCGTCCCTGCTGCCTTTGCTGCACAATTTCATAAGAATTTATAAAGGAATTTATTAAAGATTGTA
          GTTTTAAGAACCCTCACGTAATAAATACGAATGCCCCGAAG
          
          Other Products of this Gene
          Other Transcripts
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0085671
          53
          Derived from OTHER transcripts
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG15126-RA
          Secondary FlyBase IDs
            References (2)