Open Close
General Information
Symbol
Dmel\cora-RC
Species
D. melanogaster
Annotation Symbol
CG11949-RC
FlyBase ID
FBtr0086506
Feature type
Associated gene
Evidence Rank
Length (nt)
2914
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 42 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTCAGTACCAGTTTGCTCTTCGTGCACAGCACATCGAATATTTGTGAAGACGGTATTCAACGACGACGACGACGACAACA
        ACAAATTGTCTTTTTTCGCGAACGAATAGAAAAAAGTGGCAAAGAATTTGTTTACTAGTGTGAAAGCGAGTGAGTGCAGT
        GCCCACGGGAGAAAAGTGAAAACAACACAAATACAGGAGTAAAAATCAGCCAACCGCCAAACTAACGGTAACTGCGTGTC
        CTTGCTGTGGATTAAAAAGGATTCTAGAGGCGTCTTAAAAGGCTCGCTGGAAATCATTGCCGGAGAAATTCTAGAGCTCT
        TTGGAACCAACTCCAAGCTGTCGCTGGCGTAGCCAAGTCCCCCAATCCAAGATGCCGGCGGAAATTAAACCATCCGCGCC
        CGCTGAGCCGGAAACGCCGACCAAGAGCAAACCCAAGTCCAGCTCATCCTCGCACGGAAAGCCTGCCCTAGCACGAGTCA
        CCCTGCTGGATGGCTCCCTTCTGGACGTGTCCATTGATCGCAAAGCCATTGGCCGTGATGTGATCAACTCAATCTGCGCC
        GGTCTGAACCTCATCGAAAAGGACTACTTTGGTCTGACCTATGAGACGCCCACAGATCCGCGCACTTGGCTGGATCTGGA
        GAAGCCGGTATCCAAGTTCTTCCGCACGGACACTTGGCCTCTCACCTTCGCCGTCAAGTTCTATCCGCCGGAGCCATCGC
        AGCTGAAGGAGGACATCACGCGCTACCATTTGTGCCTGCAGGTGCGCAATGACATCCTGGAGGGTCGACTGCCCTGCACA
        TTCGTCACCCACGCTCTGCTCGGATCCTACTTGGTGCAGTCGGAGATGGGCGACTACGATGCAGAGGAAATGCCCACCAG
        GGCCTACCTGAAGGACTTCAAGATCGCTCCAAATCAGACGGCTGAGTTGGAGGATAAGGTCATGGATCTTCACAAGACCC
        ACAAGGGACAATCGCCCGCCGAGGCTGAGCTACACTACCTGGAGAATGCCAAGAAGCTGGCCATGTACGGCGTGGACTTG
        CATCCCGCTAAGGATTCTGAGGGCGTGGACATCATGCTGGGCGTTTGTGCCTCCGGTTTGCTCGTCTACCGCGATAAATT
        GCGCATCAACCGCTTTGCCTGGCCCAAGATTCTGAAGATCTCCTACAAGCGCCACCATTTCTACATCAAGATCCGACCGG
        GTGAATTCGAGCAGTACGAATCCACCATTGGCTTTAAGCTGGCCAACCATCGTGCCGCCAAGAAACTGTGGAAATCCTGC
        GTGGAGCACCACACCTTCTTCCGCCTGATGACCCCCGAACCGGTCAGCAAGTCCAAGATGTTCCCAGTCTTCGGGTCCAC
        CTATCGCTACAAGGGTCGCACTCAGGCCGAGAGCACGAACACACCCGTGGATCGTACTCCTCCGAAGTTCAATAGGACTC
        TGTCCGGAGCTCGTCTCACTTCCAGGAGCATGGATGCTCTGGCCTTGGCCGAAAAGGAAAAGGTGGCTAGGAAGAGCAGC
        ACCCTGGATCATCGGGGAGATCGCAATGCCGATGGCGATGCCCACAGCCGCAGTCCCATCAAGAACAAGAAGGAGAAGTT
        GATGCGACAGTCGAGCACCGGCACGGCTTCGGCCTCCTCGCAAAGTTCCCTCGAGGGTGACTACGAGACCAACCTAGAGA
        TTGAGGCCATCGAGGCTGAGCCCCCCGTTCAGGATGCTGATAAGGAGGCTAAGTTGCGTGAGAAGAAACAAAAGGAGAAG
        GAGGAGAAGGAGCGAAAGGAGCGGGAGAAGCGGGAGTTGGAGGAGAAGAAGAAGGCCGAAAAGGCTGCCAAGGCAGCACT
        TGCCGCTGGTGCCGCTGCAGGAGCGGCTGTTAATGGCAATGACGAGCTGAATGATTCCAACAAGTCTGACAAGTCCTCAG
        GCAGACGTGCTGATGCTACACCCACCGACCTGAGTGGCGCCTATGTCACGGCCACCGCAGTCACCACCCGCACCGCCACC
        ACGCACGAGGATCTGGGCAAGAACGCCAAGACGGAGCAGCTGGAGGAGAAGACGGTGGCCACCACCCGCACCCACGATCC
        CAACAAGCAGCAGCAGCGCGTCGTTACCCAGGAGGTGAAGACGACGGCGACGGTCACCAGTGGGGATCAGAAATCTCCGC
        TGTTTACGACCTCCGCCACCACTGGACCCCATGTGGAAAGCACCCGAGTGGTTCTCGGTGAGGACACACCCGGATTCTCC
        GGACATGGCGAAATCATCTCCACCCAAACCGTGAGCAGCAAAACCCGCACTGTGGAAACCATTACCTACAAAACCGAACG
        CGATGGCATTGTGGAGACCCGAGTGGAACAGAAGATAACCATTCAGTCCGATGGAGATCCGATCGATCATGACAAAGCCT
        TGGCCGAGGCAATACAAGAAGCGACGGCCATGAATCCGGACATGACAGTCGAGAAGATTGAAATTCAGCAGCAAACGCAG
        TAGATTTTATAATTATTTTTAAACCATTCGGATGATTTTCTAAGTAAACCCGCACACACACTCACACACATGAACACCAG
        CCCACGCATACGCAGCACTTGCAGTACACCTTTTATACAACCTATATCTAAATATAATTTAAACAAATATATATATATAT
        ACACACGAGTGTATATTTGAGCTCGAGCTGATGACCCACATGACATAACACTAAGAAACATAAAAAGATAAATTCCCAAT
        TATCCGTTACCGCAACCGTCTACGAGAAAATGCATCTACATGTTTATTATTTTTATTACAACTGTTGTTTATAATTACTT
        TTTATTACGTATATTATATATTGAATGTGCAAGGCAACGTTGAAATGAAAACTCTATATATTGTAAACCACGATTGCATT
        CAAATACAAGAATAAAACCTAAATGTACACACAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0086509
        5899
        FBtr0086508
        3472
        FBtr0301279
        2902
        FBtr0340468
        5605
        FBtr0340469
        5893
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0085694
        703
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085697
        1698
        FBpp0085696
        889
        FBpp0290494
        699
        FBpp0309410
        1600
        FBpp0309411
        1696
        Comments

        A cora transcript generated by alternative splicing.

        Lacks a 3kb central region of the 6.3kb transcript but contains additional

        5\' exons. This transcript was identified by cDNA analysis and is likely to

        correspond to the 2.9kb transcript observed on northern blots.

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG11949-RC
        cora+R2.9
        Secondary FlyBase IDs
        • FBtr0000862
        • FBtr0000863
        References (3)