Open Close
General Information
Symbol
Dmel\Tab2-RA
Species
D. melanogaster
Annotation Symbol
CG7417-RA
FlyBase ID
FBtr0086516
Feature type
Associated gene
Evidence Rank
Length (nt)
3249
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CAACCCACCTTTTATGGTCACACTGCTGTTTTGTGATCGCGAAAAGAGCGACGTGAAAAATACATTTAATTAAGTTTACT
      GCGAAAAATAAAATAAATAACTAAATTAAAACAAAGCGGAGCTTTTGCGTGAACTGTGTGTGTAGTTGTGAGTGTGTGAG
      AAAAGAAAAACGAAAACAAAGCCAACGAGGAAATCGAAGGGGCAAAAGTGGAAAAGATTCAGATTGAAAAGCACCAAAAT
      ATCGAAATCACAATTTGAATGTCAAAGAACAAACGACAAAAAGAGCGGAGCAACAAAGGAACATTGGAAAAGTCAAGAAT
      TTAACTTATTCGGTCTCCAGCTGTGACAAATGATGGCCTAAAATGGCGGCTACACCACCAATGCCGCCCGGATCAAACAC
      CCATCAATTGAATGGCAAAACAGTCGGCAAGGGGAACCCCCTAGCTGAGGCGATCAATCAGCACTTTCAGCGGAAGAAAC
      AGAATCAGCACCAGAGTCCCAACCCCAGTCCAAACCCGAATCCCAACAGTCCCGCCAGCCGCAGCGGGAGCTATGAGCAG
      CTGGAGCTGCTGGATCACGCAACGCATCCACAGCAACAACAGGAAGCCAGCAGTGGCAAGGCCAAGCCGAGCTGCCATTG
      CACCAACATTAGTATTATGCACCTGTTTCATGAGATGAAGCAGGAGTTCCCCACGATACCCGATGCCATAGTGACGCAAT
      GCGTCAATGAGAATTGCCATCAGCGCGAAAACTGTATCCAGATGTTGAGGAAGGAGCTCGCGCTTCATCCTATCCCAGTG
      CAGAGCTATCCGGCAAAGGTGCTGCAGCAACAGCAGCAGCAACACCACCAGAATAGGCAGGCCAAGCCTCCCACGCCGCT
      CAAGCCGTCACGGATAGCACCACCGCAGCCGGAAGCTGTGCTGAGCAATGGAGTGGCTACGCCGCCAGGTGTTGGTAGCC
      CACATCCTGATACGCAGCCCAGGCCGCGACCCACGACGCTCAATCTGCAACGTCAGTTTAGCACTCAGCTGCAGCAAAAG
      ATTATGCAGCGCCAGCAGCGACAGCAGAGGGATCACCAGCCAGCCCAGCTGACGCCCACTTCCTTGAGCAAGCCGCTACG
      CCGGGCACCGCCACTTCCGCCGCCACCCAAACCGAAGCCCGGCAGCTTCTCCAACGATTCCTCGTGTCTCACCAGTCCCA
      TGAGCTCCAGCGAATCGGAGCTTTCGCTCAACGCGGTCCCCTTATCGTCACCAACGTCGGCGGCGGCTACTGCTGCTGCG
      GCGTCAGCAGCAATCGCATCAACGCAACAACAACCCTCGCCGGTGCGACATCGTTCAGTCATAACGCTACAGCCAGAGCC
      GCCGTACGCGCGCGACTTTCGCAGCATTGACTTTCCGCCGACGACCGCGTGTACGCCGCGGCTACCCTCGCCCAGTTCGG
      CAGCGTCACCAAGTGCGCCTGGTGGACGCAAGAGCTTCACCTCGCTCAATCTCACCCTGCGCCAGCCGACGGGCTCGGCA
      CAATCGGCCATTGACATCACCGCCGGTCCGGCGCCCAGTGGGCAGGGCAGTGGGATCACCTACTCCAGCGTTAGTTTTGA
      CGCACGTCGTGGGACGCAGAAGAATTTCCAGCTGACTGTGACGGACGAGGGCAGTGTCTTCAGTGCGGGCAGCGTTCGCC
      CAAGGACCTTGTACGCAACGCCCTGTGAGCCGGTGACAAGTGTTCCGGCAAACCAGCAGCCTCCTCCGCCCGCAGCAGTG
      GTGGCAGATGGTCTGGGGGACGCTGATATGACGTCGGACGTTTTCCCATATCCCACGCAGGAGCAGAATCACATTGTGGC
      ATCCAACTATAGTAACAACCATGCCGTCAGCGACAATAACAACATTGGGATCAGCAATAGCACGGACAGTAGTCCCACCA
      TGCCCCTTTACGAAGGTGTCATGGAGGAATGCGATCGCGAAGCTCGTGCCGCCACTATCGAGCGTCAGAAGCAGCGTCGC
      GACAAGCTGGCCAATGCACTGAGGGACAACAAGAAGCGCCTGCTCGTCCTGGAGCAGGAGATCAACATCCTGACTGAGCC
      GGTGCCGGTGGGGGAATCTGAAAGACTGGATAGAGATATCAAGCAACTGACTGAGGACTGTAATCGGCTGCTTGACTGCT
      TAAATGAACCGCAGGCGAATGGCCCTGGTCCGGCGGCCAATCCCACGAACCGCCAGCACCTGTTACCAGCCAGCAATGCT
      TCACAGCAGCAGCCGCAGCAACAGCCACAGCCATTCCCGCGTCAGCGTCAAAGTGCTCGCGTCCAGGCGCCGCCCAGTTC
      ACTACGTCTGCACTCGGTGCCGGCAGCACCCATCTCCCAGCCGGTGCAGGACTTTGGGCAGCACCACAGCAGTGCTCCCA
      CCTCGGCCTGTTTAACGCCCCAGATGCAGAGTCAACAGCAACTGTTACAGCTGCAGCAGGAGCCGCCACCGACGTACGCC
      CAGTACTATCAGTTCCAGCAATATCTGCAGCAGCAGCGACAGCAGCAGTTACAACAGCAGATGCAGCAGCAACAGCAGCT
      ACAACACCAGATGCAGCAGCAACAGCAGCCGCAGCCACAACAGGAGGAAGAATTCCTGTCCGACTCCGATGTGGATGAGG
      AGGAGGAGACGCTGGACTCGTGGGCCTGCAACATGTGTACATTCCGCAACCATCCACAGCTAAATATTTGTGAGGCCTGT
      GAGAACGTTAGGATCCAGCCGGGTATGATACGCATTGTTCCCAGTGGAGGCGGGGCCGCTGCTGCTGCTGCCACGCCACC
      CGGCAGCATTGAGCAGCAACAGCAGCCGTCCCAGCAGCCGTACGCTCTGCATACATAACCCAAAAAGCTGCACCAAACGA
      TAACAAAGTTCTCTTATCGTGCATGAGCTAGCTCCTGACTGTTGTTCTTGCATGCTCGACTTTGAAACTGTGATAGCATT
      TAAACTAGTAGGCGGCAGGTTCATTATCCACTGCATGGCTCCACCTGAAAGACATGTGCGAAACGAAAACAACAGCGAAC
      GGAAACGAATTGCTTAAGCGCGGCCTTTTTAAATTATTTTAACATATTCGATTTATGTATGTACATTAAATGCAATCGCC
      TCAGCCTCAGGCCGTTTAATTTAACAATATCCTCTAACCGTTAAACTAGCATTAAGCCAACGAGAAACAGAGTTTATTAT
      TTTTAGCCCGCTCAAAAGTAAATAAAGAACGTTATTTAAATATTTACAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0305333
      3305
      FBtr0331925
      3081
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0085704
      831
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0293876
      831
      FBpp0304258
      820
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG7417-RA
      Secondary FlyBase IDs
        References (2)