Open Close
General Information
Symbol
Dmel\Spt5-RA
Species
D. melanogaster
Annotation Symbol
CG7626-RA
FlyBase ID
FBtr0086531
Feature type
Associated gene
Evidence Rank
Length (nt)
3460
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 81 )
Sequence
AACAAATTTACGACTGTCCACCACTGGCGTGGAAAGAATTACATTTTTTGCTTTTGAACAATTCGCTTAGAAAATATCTA
ATTAAACATAAAGGAAATAGACTCACATAGACAATAATGTCGGACTCGGAAGTCAGTAATATGTCGGATAGTGGCTCCGA
AGATGGATCCATTTCCAACAAGTCGCAACGGAGTGCCCGCTCCAAGTCAAGATCGCGTTCCAGGTCCGGTTCCAGGGGAT
CTCGCTCCGTTTCCAGGTCCAGATCACGCTCTCAATCGGGCCACTCTAGATCTGGCTCGGAATCTCCACAGAGACGAGAT
AATCGCGGCAAGAGCGATGAATCCGGCGAAGAGGAGGAGGAGCCACCAGGTGAGGACATCGATTCCGAGGAGTACGATGA
GGAGGAGAACGACGATCACCCAAGGAAGAAGAAAAAGAAGGAGCGTTTTGGGGGCTTCATCATTGACGAGGCCGAAGTGG
ACGATGAAGTCGATGAAGATGACGAGTGGGAAGAGGGTGCCAATGAAATTGGCATTGTTGGCAATGAGATCGATGAGCTG
GGCCCCACAGCCAGGGATATTGAAATTCGACGACGAGGCACAAACCTTTGGGACACTCAAAAGGAGGACGAGATAGAGGA
GTATCTCCGTAAGAAGTACGCCGATGAGTCAATTGCAAAACGCCACTTTGGAGATGGCGGTGAAGAGATGTCAGACGAAA
TTACCCAACAAACTCTATTGCCCGGCATCAAGGATCCCAATTTGTGGATGGTGAAATGTCGTATAGGCGAGGAGAAGGCC
ACAGCGCTTCTTCTAATGCGAAAGTACTTAACCTACCTGAACACAGACGATCCATTGCAAATCAAATCTATTATTGCACC
AGAGGGCGTCAAGGGATACATTTACCTGGAGGCCTATAAGCAGACTCATGTTAAAACTTGCATTGATAACGTGGGTAATC
TTCGGATGGGCAAATGGAAACAGGAAATGGTGCCCATCAAGGAGATGACGGATGTGCTAAAGGTGGTCAAGGAGCAGGTT
GGCCTTAAAGTGAAACAATGGGTGCGCTTGAAGCGCGGTCTCTACAAGGACGACATCGCACAGGTGGACTACGTGGATCT
GGCCCAGAACCAAGTACATCTTAAGTTGCTTCCTCGCATTGACTACACACGCATGCGAGGAGCCTTGCGAACAACAGCAA
CGGAGAGTGACGATAGCAAGCGCAAGAAGAAACGCCGCCCAGCAGCTAAACCTTTTGATCCAGAGGCCGTAAGGGCAATT
GGAGGTGAAGTACACTCAGATGGTGATTTCCTGCTCTTCGAGGGAAACCGGTATTCGCGAAAGGGATTCCTGTATAAAAA
CTTTACCATGTCGGCCATTCTCTCGGACGGTGTAAAGCCCACTTTAGCCGAGCTAGAACGCTTTGAAGAATCTCCGGAAG
AGGTAAACTTGGAAATTATGGGCACCGTGAAGGATGATCCCACTATGGCTCACTCATTCTCAATGGGCGACAATGTGGAA
GTCTGCGTGGGTGATTTGGAAAACTTACAGGCCAAGATTGTGGCTATTGACGGCACCATGATTACTGTCATGCCCAAACA
TCAGGATTTAAAGGATCCTTTGATTTTCAAAGCCAGTGAGCTGCGCAAATACTTCAAAACAGGAGATCACGCCAGAGTGT
TGGCTGGTCGTTACGAAGGCGAAACTGGCCTCATTATTCGCGTCGAGCCTACAAGAGTGGTGCTCGTCTCCGATCTAACC
AATCACGAGTTGGAGGTGCTGCCAAGGGACTTGCAACTGTGCTCGGATGTGGCCACAGGTGTGGATTGTCTCGGCCAGTT
TCAATGGGGAGATATGGTGCAACTGGATTCCCAGAATGTGGGTGTCATAGTGCGTTTGGAGAGGGAGAATTTCCATGTCT
TGGGCATGAATGGCAAGTGCATCGAGTGCAAGCCAACTGCATTGCACAAGCGAAAGGAGAACCGTCATACGGTGGCTCTG
GATGCAGATCAAAACCAAATCCGCCGGCGCGATGTAGTCAAGGTGATGGAGGGACCCCATGCAGGACGTTCCGGCGAGAT
CAAGCATTTGTATCGCAGTCTGGCCTTTCTCCATTGCCGCATGTACACGGAGAACGGTGGAATATTTGTGTGCAAGACTA
GGCATTTGCAGTTGGCTGGAGGCAGCAAGACTACCGTTAGTAATGCCGGCATTGTGGGCGGCCTAGGATTTATGTCGCCG
CGCATTCAATCGCCCATGCATCCATCCGGTGGTCGTGGAGCTCGTGGTGGCGCCCGTGGTGGACGAGGTGGTTTCCGAGT
GACCCGTGACCGTGAGATCTTGGGTAAAACCATTAAGATTAGTGGAGGACCTTATAAGGGCGCCGTGGGAATTGTGAAGG
ATGCCACCGAGAGCACGGCTCGTGTGGAACTGCATACCTCATGCCAGACGATTTCGGTAGACCGGAATCACATTGCCATT
GTGGGAGTTACCGGTAAAGAGGGCAGTGTCTCCACATATGGACGCACCCCAGCTCGCACTCCCGGCTACGGTGCCCAGAC
TCCCAGTTATACCGCTGCCGGATCGAAAACTCCGTTGGTGGGAAGCCAGACGCCCAACTGGGATACGGATACTCGTACTC
CTTATGGTACAATGACACCATCGCACGATGGCAGCATGACACCACGTCATGGCGCTTGGGATCCCACGGCAAACACAACG
CCGGCCAGGAACAACGATTTCGATTACTCCCTTGAGGAGCCCAGTCCCAGCCCTGGATACAATCCAAGTACCCCTGGCTA
TCAAATGACTTCCCAGTTTGCCCCGCAAACTCCTGGCACTCTGTATGGATCGGACAGAAGCTACAGTCCATTCAATCCCA
GCCCCAGTCCTGCTCCGTCGCCGTATCCCGTTGGTTACATGAACACTCCGTCGCCATCGACTTATTCACCGAATACTCCT
GGTGGCATACCGCAGTCGCCGTACAATCCGCAGACCCCTGGAGCCAGTCTGGACTCGTCGATGGGCGACTGGTGTACCAC
AGACATTGAAGTTCGGATTCACACGCACGACGACACCGATCTCGTTGGGCAAACGGGCATCATTCGCACCGTTTCGAACG
GCGTCTGCTCCGTATTCCTGCGCCAGGAGGATCGCAGTGTGTCCATCGTTAGTGAGCACTTGGCGCCAGTGCTACCATGC
AATGGCGACGAATTCAAGATCATCTACGGCGATGACCGCGAGTCCGTGGGCAGAGTGCTGTCCAAGGATGGCGATGTGTT
CGTCTGCAGGATTAACGAGGAAATCAAGCTGCTACCGATTAACTTCCTCTGCAAGATGAAGTCCATCGACTAAGCTCTAC
ATACGAATTGATGCTACACACTTTAAAGTTGACGGACTTCTTCAATGGAATACACATTATTGCTAAAATTAATAATTCAA
ATAAACTATTATGGACGTTT
Other Products of this Gene
Other Transcripts
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0085716
1078
Derived from OTHER transcripts
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG7626-RA
Secondary FlyBase IDs
    References (2)