Open Close
General Information
Symbol
Dmel\Ttd14-RA
Species
D. melanogaster
Annotation Symbol
CG30118-RA
FlyBase ID
FBtr0086724
Feature type
Associated gene
Evidence Rank
Length (nt)
2317
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 50 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ACAGTATAAGACCCCGTCGGCACAGGTATTCCACAAGATTCTGTTATTCGCTTGTGTAATTAACGGATGCGGTGTCAACT
      AGTAAAAATGCAATACCATCCCAAGTCGAATAAACTTTGATATTGCCCAAACAATCGAATGTGGTACAGATTGTGAAAGT
      AGCGTGCAACGCTGCCGTCTACTTAAACTTGTAAAGTTCCTCCTGCTCCGTCATCAGACTTTCTGATAGCATCCCGCGCA
      ATCCAAATTCTGGGAATGATTTCAGCGCGCCAGTGCGTCATTTAAATTGCAAAGCGCACGAGTCCGAGCCACCAGCTGGA
      TCTCCAGGATTCATAGACCAGGATCGAGACCAGGTCGGCAGAAAAGCACGAGGAGCCACAGGAGTTGCCCGAGTTCCACA
      GGCATAACCTTAAACGGCACGTGCACCGCGCGTAGAAGAGTTCTCTGCGTGCCACCACACAGCGAATCGGTTGCTCTCCC
      AAAAAACAAACACGCAATACCAAATTCCCGAAGTCGAAGACATGGCCACCCTCCTCAGCAACGGACAGCAGTCGGTAATG
      GCCAGCACCAGTAATGGTCAGGAGCAGCAACGGCACCAGGACGAACCGGAGCAGCAGCAGCAGGTCGAGATCAGAAAGTC
      GAGCTCACCGAAACCAGGCGCCATGCCCAGCTTGAAGCTGAACAGAATGGGTTCGGTGTCACCGAAAGATAAACGAGTCT
      ACAAAATCGTCCTCACTGGCGGGCCTTGCGGCGGAAAGACGACGGGACAGTCCCGCTTGTGCACTTTCTTCGAAAACCTT
      GGATGGAAGGTATTCCGCGTGCCTGAAACGGCCACTGTTTTACTCAGTGGCGGTGTGAAGTTCTCCGATCTGACCGAGAA
      AGAGGCCTACAAGTTCCAGGAGAATCTGATCCGCACCATGGTTCAAATTGAGAACACCTACTTTGAGCTGGGCAACTCCA
      GCAATCGCAACTGTCTGATAATCTGCGATCGCGGCGTTATGGATGCCAGTGCATACATATCCAAGGATAAATGGGAAAAG
      ATGATGGCGGGCAATAATTGGAATCCCGTGGAGATGCGCGACAATCGTTACAACCAAATCCTGCACTTGGTTTCGGCTGC
      CAACGGCGCCGAGGATTTCTACTCCACAGAGGACCATGCCTGTCGCTCGGAGGGCGTTGATTTGGCCCGGGAACTGGACT
      ACAAATCCGCCGCCGCCTGGGTTGGCCATCCCTACTTCGATGTGATCGACAACTCCACCAACTTCGAGACCAAGATGAAT
      CGCATGATTGAGTCGGTGTGCCAGAAATTGGGCATTGATATTGGCGACCGTTTGCAGGCCACGTCGCGCAAGCTGAAATA
      TTTGGTGGCCCTTTTGCCGCCGGACAGCGAGTTTCCGCCCTTCCAGGATTTCGATGTCGTACATCATTATCTGCAGTCCG
      CCGGACCCAAGGTGCAGGCTCGCCTTCGCAAGCGTGGACAGAAGAACCACTGGAGCTACATCCACACGCAGCGGCGTCCA
      AACGTTCACGGGCAGGCCCGCATTGAGGTGAAGACCCAGCTGACGCATCGTGACTACATGAACTTGCTGGCCCAGCGCGA
      CGATGCTCACTTCACCATCTACAAGAAGCGCCGCTGCTTCCTTATCAACAACCAATATTTTCAGCTTGATATTTATAAGG
      AGCCAGGCCACCCACGCTGCAAGGGATTGGTGCTTTTGGAGACGTATTCGTCACTCACCGGCGATGCCCTGAAGAACTGC
      ATGCCCAAGTTCCTGAACATTGTAAAGGAGGTGACCGGCGATCCGGACTACTCCATGTTTAATCTATCCCTCAAGGAGGA
      CTGGAGCACCACGAAGAAGTTTTGCCGATCGGCGACGCACGGTAAGCAGGAGGAGCAGTCGCCAGTGCCGGCAAAGCAGT
      ATCATCCATATGACGAGAACAGCGATTAGGGCATGAGGCCAGGAGTCAACATAATCCATAGCCAAAGAGAATGGAACCAA
      AAGATTATAGTTTCACTGCTGTACATAATATAAGCTTCTATCTTTCGTTGCTCCAATGCATGCCACCTCATTTCACTTTC
      ATTTTCTATTCTTTTCAAAATTTCAAATTGATTGTAATCGTTTTGGATTTGATTTTCGCCTGACTATGTTTCTCTTTTGA
      TTTTGTAGTTAAGGGCGCCGCTAATGGAGTCTCGAGCACGCCGCTGCTCCTCAATGGTCAGTAGGCTTCCGAACTGTCCC
      TGAATCTCTTTTGCACACGCATATTACACGGCAAAAGCAAATTATAAGAACACCAATGACCTGGCAATGAAATGTAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0113360
      2030
      FBtr0113361
      2584
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0085903
      475
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0112272
      471
      FBpp0112273
      515
      Comments
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (3)
      Reported As
      Symbol Synonym
      CG16859-RB
      CG30118-RA
      Ttd14-RA
      Secondary FlyBase IDs
        References (2)