Open Close
General Information
Symbol
Dmel\Patronin-RB
Species
D. melanogaster
Annotation Symbol
CG33130-RB
FlyBase ID
FBtr0086949
Feature type
Associated gene
Evidence Rank
Length (nt)
5163
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 30 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TCACATGAAAATTTGTAAGATTTTAGAGCAGATCGGTGTCCGTGATTTTCTCAATTTAAGCCCAATTTGTAGTATTAAAG
      CTGTTGAAAAATGCAGCGGGGACGAGCGCGAACCGTGTGAAATGCATGCGAAAGTCGTCGGTGCAGCAAATCAGTGCGAA
      AAACATCCCAAATGCTCCAAGTGAAAATCACCTAAGCTGAGGAAAACTCCAAGCCACACTCACACACACACGCACTCGCT
      CGCACGCAGAAAAGAGACAAGTGAAAAAGGAAAAGCGGTGTGTTGTGGTCAAACATAGAGTGCGAAAAGTGCAAAAAGTG
      CGGAAAGTGAAGTGGCGGGCGTCGGAGAGCCGGAGTCCGTCGCAGGAAAATCCGTCAGCATGGATGTCGAAACACAGGAA
      ATACGACAGGCTCGTCAACGTGCTTCCGTCAAATGGCTGCTCTCAAAGGCGTTCAACAATCGCGTGCCAGACAACCTGAA
      GGAGCCCTTCTACCGCGACCATGAGAACCAGGAGCGCCTCAAGCCGCAGATCATCGTGGAGCTGGGCAATGCCACGCTCT
      ACTGCCAGACGCTGGCCAATCTGTACTCAGATCCCAACTACCAAAGCATGAACCACTGGTCAATAATACAGACGCTAGCG
      CGCAAGGGAGTTCCCGTGGCCGAATCCGCGGACATGCCCATTACCGAAACGGTATTAATTCAAACAAATCCGCTGCGAAT
      TAACGCCCACATGTCTGTGATAGAATCGCTGATGGTTTTGTATGCGAAGGAAATATCATCGGGTGACCGCGTCATGGCGG
      CCATACGAAGAATATCTGGCAACAACTATCAGGCACCCACTGGCCAGTCCTACGAGCAAGCTCTGCTGGGCTGGATTTCA
      CATGCTTGCGCCGCTCTGAAAAAGCGCATTATCAAGGAGGTGGACGCTGGGCTGCCCGACGATAATGGTTCACGTCTGCA
      GACGCCGGATATACCACCTGTAAGGGACTTCCAGGATCTGTGCGATGGCATCTGTTTGGCGCTGCTCATCTCCTACTACT
      GCCCAAAGGTGGTGCCGTGGACGAGTGTGCGGATTAACTATTTGCCCGCCGTCGAGGACTCTATTCACAACATCCTGCTG
      GTCTGCAATTTCTCGCAGAAGCATCTGCCCTACACCGTGATGCATATGACGCCCGAGGATGTGACCTACATGCGCGGATC
      CATGAAACTGAATCTGGTAGTGCTGCTGACGGATCTGTTCAATCTGTTCGAAATACACCCGGCCAAATGTGTCTGCTATC
      CCGGCATGGATGGTCAGGTTCCGCACTCGAATTCATTTGGCGGCGGCTTAAATCGCAGATCAACCCCGCCCAACGAATAC
      CAGACGGTTCAGTCAAATAATTTTGACGGTAATCATGCCGAAGCCTTCGTGGTGCACAAGTCGCGTGGCATCACCACACT
      CGCCTCCATGCACTCGCAGCAGCAGCAGCAGCTCCATCAGCAGCAACAGCATCAGCAGCAATACCATCAGCAGCCACTGC
      AGCAGCACCCGTCCCAGTCGCAGCTTCAAATCCAACAGCAGGAGCCCTTGGTTCCAGCTCGCTTGCGCCAGGCTAAAGAA
      AAGACCAATGTTGAGTCGAAGGCGGACGAGAGAGGCGATTTTGTCGCTGCGGGTCGACCAAGTAACTGGGAACAGAGCCG
      CCGGCCAAGCTTTGCAGGTCGTCGCTCGCGCAGAAACTCCTCCAGCGAGGACTCCCAGCTGACCATTGAGAACTTTGGTG
      GCTCGCAGGATCAGCTGAATACGCTGGGACGATACGAACGCGACAGGGAACGCAAATTGTCCAACACCAGTGTGGGCAGT
      TATCCAGTTGAACCCGCTGTGGCCGTTCGCTCTTCAATTGCCGATGCTAGGGGCACGTTGCAGTTGGGCTACGATACGGA
      CTCCGGCTCTGAGAAGCAGGATCGCGAAACGGAAAAGTATTCGATGCGCCGGCAAGTCAGTGTTGACAATGTGCCCACGG
      TGTCGTCGCACAATCTTTCGAATGCGGGCAGCCCGTTGCCGGTGGCTAGGCACAAGCAACATTCCAGCGACAAAGACTAC
      AGCAGCAACAGCGGCATGACACCAGATGCATACAACGATTCCCGCTCCACCAGTGGCTATGATCCGGAGAGCACGCCCGT
      TCGCAAGTCCTCGACTAGCAGCATGCCAGCAAGTCCCGCTGCCTGGCAGTTAGATGTGGGAGACGACGATATGCGCTCGC
      TGGAAAACGCCAGCAAGTTGTCCACAATTCGAATGAAACTGGAGGAGAAGCGGCGGCGCATTGAGCAGGACAAGCGCAAG
      ATCGAGATGGCCTTGCTGCGGCACCAGGAGAAGGAGGATTTGGAATCGTGTCCGGACGTGATGAAGTGGGAGACCATGAG
      CAACGAATCAAAGAGAACACCTGATATGGATCCCGTGGATTTGGACAAGTACCAGGCCTACAACGCCCCAGTCAGCGCAT
      ACAGCTCCCGTCCGCCCAGTCGCGATCCCTACCAGCAGCAGCTCCACCATCAGCAGCAGCAGCCCATGCCCATGCCGCAA
      CCGATGCAGTACGTCAACGAGCATGGGCAGTATATGTCGCCGCCGCAGCCCGCACACTACATGCCGCAGCAGGCACAACA
      GCCGCAGAGCATTTACAGCGACAACGGGGCGGCGTACAATCACAGTAACCACTCGCCATATGGCGGAACTCCACAGTATC
      GGAGCAGCGTGGTGTACGACGATTACGGGCAGCCCACCAACCACTTCTACCTGCATGAGTCATCGCCGCAGCCTCAAGCT
      CATCAGCATCCGCAGCGCAGGACTTGGGCTCACTCCGCAGCAGCCGCCGCTTATGAACAACAGCAACAGATCCAGCCTTC
      CCTGGTGGATGTGAATGCCTGGCAGACGCAGCAGCACCAAAAGCAGAAGCAGACCTGGATGAACAGGCCGCCCTCGAGTG
      CGGGAGCCCCGAGTCCTGGCAGCTTTATGCTGCACCAGAACGGTGGAGGAGGAGGTGGTGGCGGTGGTGGTGGCGAGCTA
      CAGCACCTGTTTCAGGTACAGGCCTCGCCACAGCATGGCCAACGGCAGGTTAGTGGATCCAATGGCGTGCAGCGCCAGCA
      GTCGTTGACCAACTTGCGAGACAATCGCTCGCCCAAGGCACCACAAAACATGGGAATGCCCATGGGTATGCCAATGCAGC
      AAGAGGACATGATGGCACCGCAGAGTATTTGCTTTATCGGTGACGAGGAGGATGTTGATGAGCTGGAGCGGAACATCATC
      GAATCTATGCAGTCGACGCACATCTCCGACTTTGTACACCAACAGCAGCAGCAGCACCAACACCAACAGCAACTTCAGCA
      GCAACAACGGTTGCAGGGGCACAGCGGACGAGGTAGCAGCTCGGAGGATTATGACAGCGGGGAGATGATCTCCAACAAGC
      TGAACATCACCAGCGGCAATCTCACCTATCGCATACCCTCGCCATCCCGTCCCTCCATCCAAGCCAACAGCTTCCAGGAT
      CCCCGAGCCATGGCAGCTGCTTCCGGTGGCGAGGACCAGCCGCCCGAGAAGGGTTTCTACATCTCCTTCGACGATGAGCA
      GCCCAAACGACCCAAGCCACCTCTGCGCGCCAAGCGATCGCCTAAAAAGGAGTCTCCACCAGGAAGTCGGGACAGCGTCG
      ATAACCAGGCGACCCTGAAACGTGAATCGCTAAGTCATCTGCACAACAACAACAATATTGGATTCGGAAATGATGATGTC
      AACAGCAAACCGGTGACCAGGCACAGTATCCATGGCCTAAACAACTCCAACAGTGTCAAATCTCCCGGAAATGCCACGTA
      CAACAAGTACACGGATGAGCCGCCCATCCAACTGCGACAGTTGGCCGTTTCGGGAGCAATGTCACCAACTAGTAACGAAC
      GTCATCACTTGGACGATGTCAGCAATCAGTCACCGCAGCAGACGCAGCAACCAATGTCGCCCACGCGACTCCAACAGAGC
      AGCAACAACGCAGAGGCGGCCAAGAACAAGGCGCTGGTCATCGGAGCAGATTCCACCAATTTGGATCCGGAATCTGTTGA
      TGAGATGGAGCGGCGCAAGGAGAAAATCATGCTGCTGTCTTTGCAACGTCGCCAGCAACAGGAGGAGGCGAAGGCGCGCA
      AAGAGATTGAGGCTTCCCAGAAGCGAGAAAAGGAGCGCGAAAAGGAGGAGGAACGAGCGCGGAAAAAGGAGGAGCAAATG
      GCACGGCGAGCGGCCATTTTGGAGCAGCACAGACTCAAGAAAGCCATTGAAGAGGCCGAGCGAGAGGGTAAAACCCTGGA
      TCGGCCCGATCTGCACGTGAAGCTGCAATCGCATTCATCCACCTCAACGACCCCACGACTGAGGCAGCAGCGCACCACGC
      GTCCCAGGCCTAAGACAATTCACGTGGACGATGCCAGCGTGGACATCAGCGAGGCTTCAAGCATCTCTAGTCGGGGCAAA
      AAAGGCTCAAGCTCGAATCTAACCGATTCGGGACTGGGACGCGCCACTCCGCCGAGGCGTGCTCCGTCGCCTGGAATGGG
      AATGGGCGCTTCAGGTCCTAAACTCTATAAACAACCAGCGGCCAAATCGAATCGTGGAATCATCCTGAATGCCGTTGAAT
      ACTGTGTTTTTCCCGGCGTTGTTAACCGCGAGGCCAAACAGAAAGTGCTGGAGAAGATTGCGCGCTCGGAGGCGAAGCAC
      TTCCTGGTACTCTTCCGCGATGCTGGCTGCCAGTTCCGCGCCCTCTACAGCTACCAGCCCGAAACGGACCAGGTAACCAA
      GCTGTATGGTACTGGGCCTAGTCAAGTCGAAGAAGTCATGTTCGACAAGTTTTTCAAATACAACTCAGGAGGCAAGTGCT
      TCTCGCAAGTGCATACAAAGCATCTGACAGTGACCATCGACGCCTTCACAATACACAACTCCCTGTGGCAGGGCAAGCGG
      GTACAGTTGCCCAGCAAAAAAGACATGGCGCTTGTAATCTAAGCGGTGGGCTGAGTATTCTGAGTGGCATCTCGATTCGG
      ATGCAGAAGGGTGGCGGCAGTGGAGCGGTTTGGCCAACGGGCGCTTGGCGCGGTTTTGGTCGCAACCACACTATTCTACA
      AGATTGCGCATTAAGACATCTATGGAAGCATAACAAAACATAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0086948
      5507
      FBtr0086950
      6018
      FBtr0273446
      6782
      FBtr0273447
      5925
      FBtr0300603
      6141
      FBtr0332260
      6195
      FBtr0332261
      6150
      FBtr0332262
      6168
      FBtr0332263
      5742
      FBtr0332264
      5640
      FBtr0332265
      6110
      FBtr0332266
      6177
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0086105
      1540
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0086104
      1517
      FBpp0086106
      1630
      FBpp0271954
      1663
      FBpp0271955
      1599
      FBpp0289830
      1671
      FBpp0304550
      1689
      FBpp0304551
      1674
      FBpp0304552
      1680
      FBpp0304553
      1538
      FBpp0304554
      1504
      FBpp0304555
      1439
      FBpp0304556
      1683
      Comments

      Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (3)
      Reported As
      Symbol Synonym
      Patronin-RB
      l(2)k07433-RB
      ssp4-RB
      Secondary FlyBase IDs
        References (0)