Open Close
General Information
Symbol
Dmel\RhoGEF2-RD
Species
D. melanogaster
Annotation Symbol
CG9635-RD
FlyBase ID
FBtr0086971
Feature type
Associated gene
Evidence Rank
Length (nt)
8475
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 46 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CACTGGCAGATATGCGCTCTTTCTCGTCATTTCATTCCAATTTTCAAGCTGAAAAGAAAAGAACGTCGTGTGCGTGTTGA
          TGGCGCGATAAGTGAAAAAAATAAAAACATTTTTCGTGTCTTTATGGAATACAATACGAGTTTAAGTGAAAAGTAGCAGT
          GCAAAATATATATACACATATCAAAACCCATTGGAATAGTGCAACCAAAAAATCATAAAACAGAACTAAAGCAACGAAAA
          TCGAGGCAATTAAATCACTTCTGGATTCATTTCGGCCCGTTTTTACTAGCTAATTTAAAAATAGCTGCCGAAAGCATTCC
          GCAACCACTTCTGGTGACTGGCCCCACACCAATGCGAACAATACTCCACGGGATCCTCCGACTTCGAGTGGCTTACGCAT
          GCCTTTGAATTTGCATCTTCGCACCCGCACAGCAGCCAGCAAAAGCCATCGCAGGAAACCCTATGGATGACCCATCAATC
          AAAAAACGGTTACTAGATTTATATACTGACGAACATGAATACGATGAGGTTCAAGAGATACCAGAAGAGTCAAGCATTCA
          GCCCCCGGAGACATCAACGAGCCATACCAGCACAAACGGATCCAGCCACTCAGGCCCTGGAACTGCAACTGGACCAGGAG
          CGACATCTGCAGGCCCGTCAGCGGGTGCGCCACAGTCACCAGTAATTGTTGTGGACTCGGTTCCCGAGCTGCCAGCGCCC
          AAGCAGAAATCTGTTAAGAACTCGAAGAGCAAACAGAAGCAAAAGCAGTTGGCGAACAAATCGAAGATTCCACGATCTCC
          TTCGTTGGCGAGCAGCCTGAGTAGTCTGGCCAGCAGCCTTAGTGGTCATAGGGATCGGGACAAAGATCGGGACAAGGATC
          GGGAGAACCAGAACGCCGTGCCGCCGCAGACGCCGCCGTTGCCACCGAGCTACAAGCAGAACCAAATGAATGGTGACTCT
          ACGGCTGCAGCTGGTGGTGGTGTTTCTGCCCCAGCCACGCCCACCACCGCCAATAATAACAATGCGAGCCACAACAACGG
          CAGCATAATGGGCGGAGGCGTGCAATTGAATCAATCGGACAACTCCAACCCCGTTCTCCAGGCGCCGGGGGAGCGCAGTA
          GCCTCAATCTGACTCCCCTCTCCCGGGATCTGAGTGGTGGCCACACCCAGGAGTCCACGACGCCAGCGACCACGCCGAGT
          ACGCCAAGCCTAGCATTACCAAAAAATTTTCAGTATTTAACCCTGACTGTGCGAAAAGATAGCAACGGATACGGGATGAA
          GGTTTCCGGAGATAATCCTGTGTTTGTGGAGAGCGTTAAACCCGGAGGCGCAGCGGAGATTGCAGGCCTGGTTGCTGGCG
          ATATGATACTAAGGGTAAACGGCCATGAAGTGCGACTAGAGAAGCATCCAACTGTAGTGGGTCTTATAAAAGCCTCGACA
          ACTGTTGAGCTGGCGGTGAAGCGAAGTCAGAAGCTAACGCGACCCTCTTCGGTATCAGTGGTAACGCCCTCGACACCCAT
          TCTCTCTGGACGAGATCGTACCGCTTCAATAACTGGGCCACAGCCGGTGGACAGTATTAAACGAAGGGAGATGGAGACTT
          ACAAAATTCAGACGTTGCAGAAAATGCTGGAGCAGGAGAAACTAAATCTGGAGCGATTAAAAAGCGATCAAAATAATCCG
          AGCTACAAGCTATCTGAGGCGAATATCCGTAAGCTGCGCGAGCAACTTCATCAAGTGGGAGCTGAGGATGCACCGACTGT
          TAAACTTCAGGCGGCCGCTGGCAATAAGAACACAGCATTACTAACGCCCAACCAAATCCAACACTTGTCCGCGTCCGCCA
          CTCACAGCAATCAGCAATTCCATCATCTTCACCACCACCACAATCTCCACAACAACAATTATCCGCCACAGCAACAGCCA
          GCTAGCACCTCACCCGCATTCCTGTCCCTCCTGCCGCGTTCCCTTTCGTCCTTGTCGCTGGGCACGCGCAAAAACAAGAC
          CGAAAAGGACCTAACGACTTCATCTCCCTTTGGCCTAACGACGGATTTCCTGCAGCAGCAACGGATGAGCCACCAAGCGG
          AGTCGATGTCTCAATCGATGCATCAGCACACCAGCACTCCGACCTCGCAGCAGTTCTTCCATCCGCATCAGCAACAACAT
          CGCTTTAAGGAAACTGGACCGACGTCGAAAGGCAAGAACAAGTTCCTAATTTCGAGGAGTTTGATCGAGGAGGATGTGCC
          GCCACCACTGCCGCAGAGGAATCCGCCCAGGCAGTTAAATTTGGACCTGAAGAACGGAAACGCGTCGCCGGGTGGGTCAC
          ATCTAGTGGCTCCAGTTTCCGATCTGGATCGCGCCACAAGTCCCCAATTAAATAGATCCCAACAACAGCAACTGCCTAGC
          AGCACTGACAACAGCCCGAGCAATGCCAAGTCCAAGCGTTCCAAGATCAAAACGAAGGCCCTATCGGATCCTAAGATGTC
          CACTCAGATGTTCCTGCAAATGGAATCGGCGAGTGCAGCTGGAGCAGCCGGAGGTTCCATCGAGGTAGATGGGGGTCCAC
          CACCGCTACCGCCTCGCTTGCCTGGCATGATGACGGAGGATATGAGCCGCGGCAGCTGTCAGAATCTCGCTCAACCCAAT
          TCCGTGGGCACTGCCTTCAACTATCCTCTGGTGTCCACAACAACAGCGGTGCAGAACGATAACCTGAACATTGCCTTTCC
          TTTGTCCCAACGACCCAACATTGTCCAGCAGCTGCAGCAATATCAACAGCAGCAGCAGCATCAAATGAGCGGTGGCCAGG
          CCACAGGCGCTCTGGGACAGACTCCGAATTTGGGAAAAAACAAGCATCGACGCGTTGGTTCTTCACCGGACAATATGCAT
          CCACGTCATCCAGATCGGATAACGAAAACGACTTCGGGCTCGTGGGAGATTGTTGAAAAGGATGGCGAATCCTCCCCGCC
          CGGAACACCGCCGCCTCCATATCTATCCAGCTCCCACATGACCGTGCTGGAAGATCCGAATGAGAACAATCGTGGAGCAG
          CAGCAGCCGGACCTGGAGTCTTTATCGAGTCGCATCAGTTTACGCCGATGGCGGGAGCCTCTTCTCCGATCCCGATATCC
          TTACATTCCAGCCACATGCATGCGGCCCAGTCGAACGATACGCAGAAGGAGATCATCTCGATGGAGGACGAAAACTCGGA
          CTTGGATGAGCCCTTCATTGACGAGAACGGACCCTTTAACAATCTAACTCGTTTGTTAGAGGCCGAGAACGTCACTTTCC
          TAGCCATCTTCCTAAACTACGTGATCTCAAACTCGGATCCCGCGCCACTTCTGTTTTACCTGATTACTGAGTTGTACAAG
          GAGGGCACCTCCAAGGACATGCGGAAATGGGCCTACGAAATCCACTCCACATTCCTCGTGCCGCGGGCTCCATTGTCATG
          GTATCGCCAAGATGAATCGCTGGCCCGCGAGGTGGATAATGTCCTGCAGTTGGAGTATGACAAAGTGGAGATCCTAAGGA
          CAGTTTTTCTGCGTAGCCGAAAGCGGGCCAAGGACCTAATCAGTGAGCAGCTGCGTGAGTTTCAGCAGAAGCGCACCGCC
          GGCCTGGGAACCATTTACGGACCCACGGACGACAAGCTGGCCGAGGCGAAGACGGATAAGCTAAGGGAGCAAATCATCGA
          CAAATATTTAATGCCCAATCTTCACGCGCTTATTGAGGATGAGAACGGTTCACCGCCGGAGGATGTACGCAAGGTGGCGT
          TGTGTTCTGCTCTTTCCACCGTCATCTACCGTATTTTCAACACTCGTCCGCCTCCAAGCAGCATCGTTGAGCGGGTCCAT
          CACTTTGTGAGCAGGGACAAGAGTTTCAAGTCGCGTATTATGGGCAAAAATCGCAAGATGAATGTTCGTGGTCATCCATT
          GGTATTGCGTCAATACTATGAAGTGACGCACTGCAATCATTGTCAGACGATTATCTGGGGCGTGAGCCCGCAAGGTTATC
          ATTGTACAGACTGTAAATTGAACATACACCGTCAGTGCTCGAAAGTAGTGGACGAGAGTTGTCCCGGTCCCTTGCCCCAG
          GCAAAACGTCTCGCCCACAACGACAAGATCAGTAAATTCATGGGCAAAATTCGACCGCGTACCAGCGACGTCATTGGAAA
          TGAAAAGCGAAGTCGTCAAGATGAGGAATTGGATGTTGAGTTGACTCCAGACCGTGGTCAGGCGTCGATTGTGCGTCAAC
          CCTCTGATCGGCGACCGGATGCGAACATATCGATAAGGTCGAATGGAAATACCTCCTGCAACACTTCGGGGCTGAACACC
          ACCGACCTGCAAAGTTCTTTTCACGGCAGCTGTGCCAACGACAGTATTAACCCCGGCGGTGGAGCCGGATGCAACATGGA
          TTTATCCACGAGCGTGGCGTCAACGACTCCGTCGACCAGTGGATCCGTGGCAGCCGGTCTGAGTGCTTTTGCCGAACTGA
          ACGCCCTGGATACAGTGGATAAAGAAGCGCGTAGGGAGCGTTACAGTCAGCATCCGAAGCACAAAAGTGCACCAGTCTCT
          GTGAATCGGTCGGAATCCTACAAGGAGCGCTTGTCCAACAAGAGGAACCGCAACAGTCGCCGCAAGACCTCTGATCCAAG
          CTTGTCGTCGCGTCCCAATGATGAACAACTGGACTTGGGTCTATCGAATGCCACTTATGTGGGCAGTTCGAATTCTAGTC
          TCTCTTCAGCTGGCGGCAGCGAGAGTCCCAGCACGTCAATGGAGCACTTTGCTGCACCCGGAGCAGCGGGTGGCGTCCAG
          GTGCCGCCAATGGGATTGAACCAGAACCAGCACCCCCATCTGCTCATCCAGCAGCACGCCCAGCAGTACTGCCAGCAGGA
          TTCCTTTCAGGCGGGTTTGGCAGGGGCCGCTGGGAGCAGTGCAGCTAGCAACTCTAGTTTCTGGAATGCTGGCCACCCAT
          TGCCTGTAGCTCGTTGGACGCTGGAGAGCGAGGATGAAGACGACGTGAACGAGGCGGACTGGAGTTCCATGGTGGCCGCA
          GAGGTGTTGGCAGCCTTAACGGACGCTGAGAAGAAGCGTCAGGAGATTATAAATGAAATCTATCAAACTGAACGCAACCA
          TGTGCGCACCCTAAAGCTGCTGGATCGATTATTCTTCCTGCCACTCTACGAGAGTGGATTGCTGTCCCAGGATCATTTGC
          TGTTGTTGTTCCCGCCCGCCTTGCTGTCGCTCCGTGAGATTCATGGCGCCTTCGAGCAGAGTCTTAAGCAACGACGCATC
          GAGCATAACCACGTGGTGAACACCATAGGGGATCTGCTCGCCGACATGTTCGATGGTCAGTCTGGAGTTGTTCTTTGCGA
          GTTTGCGGCTCAGTTCTGTGCCCGCCAGCAAATCGCCTTGGAGGCACTCAAGGAGAAGCGCAACAAGGACGAGATGCTGC
          AAAAGCTATTGAAAAAGTCGGAGTCACACAAGGCATGTCGCCGCCTCGAGCTAAAGGACTTGCTGCCCACCGTGCTGCAG
          CGCCTCACCAAGTATCCGCTTTTGTTTGAGAACCTTTACAAGGTGACCGTGCGCTTGCTGCCAGAAAACACCACCGAGGC
          GGAAGCCATTCAACGGGCAGTGGAATCCTCTAAAAGGATTCTTGTCGAGGTCAACCAGGCAGTAAAGACAGCAGAGGATG
          CTCACAAGCTGCAAAACATTCAGCGTAAGTTAGACAGATCCTCCTATGACAAGGAAGAGTTTAAGAAATTGGACCTGACC
          CAACATCACCTCATCCATGACGGCAATCTGACGATCAAGAAGAATCCTAGCGTGCAGCTACATGGACTTCTGTTTGAAAA
          CATGATTGTTTTGCTGACCAAGCAGGATGATAAATATTATCTAAAGAACTTGCACACCCCGCTATCGATCACCAATAAGC
          CAGTCAGTCCAATTATGAGCATTGATGCGGACACTTTGATCCGGCAGGAGGCGGCTGATAAAAATTCCTTTTTCCTCATC
          AAGATGAAGACATCACAAATGTTGGAGCTACGCGCGCCTAGTAGCTCGGAGTGCAAGACATGGTTTAAACACTTCTCGGA
          TGTGGCTGCTCGTCAGTCTAAGAATCGTTCAAAGAACGCATCAAGCAACCATGACACGAGTATTAGTGATCCAGCTCTCG
          CCGCTATTCCGCATTCCAACACCAAAGAGTCGTTGGAGTTGAGCACTGATACAGTACAGCCATTGGCTGCGACAGCCACA
          TTGACTACCACACCATTGGCCCCAATGCTGCCTATAGCCACGGTTACACCGGCTCCAGCGACCAATAATAGTAACGTTAG
          CTCTCTTACTGGAGTTCAGTTGCGAAACCCTCAACGGGATGCGACAGCAAGTGAATCTGATGCGGATTATGTAAACACAC
          CAAAGCCGCGTTCGAGCCAAAATGAAGTTAATCGCACTATGTCCATAAGAAGCACTGGCGAACCCATTCAGAAGTATTCG
          GCGAATGGGACGGAAGCAAACGACGTTACTTTACGACACTCTCAGTCGACTAGGGAATCGGTTAGACCAGGATCTACTGG
          GGAGGAGCGAAACTCCACGTATGGTATGGTTGGAGGTAACTCCAAACGCGACAGCGCCAGCATTGTCTGCTCGAACAACT
          CGAACAACACGCGCACCCTTCTGATGCAGAGTCCCTTGGTGGACCCTACGGCCATTCAGGTCAGCATTAGTCCCGCTCAC
          ACAGCGGAACCTGTGTTGACACCAGGAGAGAAGTTACGCCGCTTGGACGCCTCCATTAGGAATGATTTGCTGGAGAAGCA
          GAAAATCATTTGTGATATCTTCCGTTTGCCAGTGGAACACTACGACCAGATTGTGGACATTGCCATGATGCCAGAGGCGC
          CGAAAGACAGTGCAGATATTGCTTTAGCTGCTTACGATCAGATTCAAACCCTGACCAAGATGCTGAACGAGTACATGCAC
          GTCACGCCTGAGCAAGAGGTCTCAGCGGTGTCCACGGCGGTTTGTGGCCACTGTCACGAGAAGGAAAAGCTTCGTAAGAA
          GGTGGCACCATCCTCATCGTTTTCTTCATCACCACCACCGCTGCCGCCTCCCAATAGGCAGCATGCCCAGGCTCAGGCCC
          AGATACCGCCATCGCGGCTGATGCCCAAACTACAAACTCTTGATCTTGACGAAGTTGCCATACACGAAGACGATGACGGA
          TACTGTGAGATCGACGAACTGCGCTTACCGGCTATTCCGTCCAAACCACATGAGCGGCCCACAACGCCACTGGCTCCTTT
          CAATACTGAGCCGAAAACTTCACAATCTGTTATAGATGCCTCGAAACGTCAATCCACTGATGCCGTTCCGGAGGGATTAC
          TGGAACAAGAACCACTCGAAGGCGATAAGACGGAGACCAAGGGTGAAGATAATGAAGTGAAAACTGTGCCGTCAGATAAG
          CTAAGTGAATCATGCAATGAAGAGAGGCAATGTGTGGAGGCGGATATCACAAAGGAAGTGGCAGATCCAACGACCTCTAA
          GAATGAAGCTGCAGCATCGGTGGATGAATTACCAAGCCAGAGCCGGGAGATAAAAACGGCTGAAAACGCAAGCAAATCTG
          TAGCTGACAAAAAGGAAGACAACGAGGAAACCATCGAAGAAGGTGTGGCATCCACGGTCGATAGCTCCACTCAAACATCA
          CCAACTGAATCGCCGAAAGAGACGGATAAGTTAACTGGAGGATCGAGCAGCACCTGTGGGCCGAATCGCATTCAGCACGC
          TAGTGTGCTGGAGCCGAGTGTGCCCTGCCATGCACTCAGCAGCATTGTAACAATACTGAATGAGCAGATTTCCATGCTTT
          TGCCAAAAATTAACGAACGCGATATGGAAAGGGAGCGATTGCGTAAAGAGAATCAACACCTTCGCGAGCTCTTGAGTGCG
          CTGCATGATCGACAGCGAGTTGATGAAGTAAAGGAAACTCCGTTTGATCTAAAGAAGCTGATGCATGCTGAGGATGTAGA
          GTTTGACGATGATATTGACGCCATTTCCAACAGTTCGCTGACGCCAACGCCTACGCCGATTCCCACAGCATCACCAAGCG
          CCAGCGGCCAGGTAGAGACAGCGGAAGCCATGAGGATTACTAGCACTGAGGATGAGGAATAGGAAACTTGTTTAATTTTT
          TTTTGTATAAAATACATATTTGTTCTTGTTTTTCCCGCACGCATTTGACCAATTGAATTGGCGGCGTCTATGTTTTACGA
          GTAGCCTTTCTTAGAGCATGCCTTTTACTACTGTTAATGTAGCTTCATTTGTTTTCTTAAAATATTATGTATTCCACAAG
          AGCCGATAACACTTTAAATTAAGTCTAACATTGTCCCCTCGTAAAACTAATTAAATACATATATATATGCATATTATCGA
          CTTAAAAAATATCAGATAAACACACAATGTTTGATACATTTATAAAGAACAATAAACAACATAGTTATTGAGAAG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0086969
          7424
          FBtr0086970
          8486
          FBtr0305083
          8480
          FBtr0340124
          8166
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0086125
          2559
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0086123
          2205
          FBpp0086124
          2559
          FBpp0293620
          2557
          FBpp0309117
          2456
          Comments

          GC splice donor site postulated.

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG9635-RD
          RhoGEF2-RD
          Secondary FlyBase IDs
            References (2)