A Database of Drosophila Genes & Genomes

FB2013_03, released May 7th, 2013
 

Transcript Dmel\Mtk-RA

General Information
Symbol Dmel\Mtk-RA Species D. melanogaster
Annotation Symbol CG8175-RA FlyBase ID FBtr0087386
Feature type mRNA Associated gene Dmel\Mtk
Evidence Rank Strongly Supported Length (nt) 268
Evidence Score 11
Map ( GBrowse ) GBrowse View Help detailed view FBtr0330008 FBtr0330015 FBtr0330013 FBtr0330007 FBtr0330012 FBtr0330011 FBtr0330014 FBtr0087386
hide Recent Updates
Description
What does this section display?
This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
Update Feed
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates Click here to see a list of all updates to this record from FB2010_08 and on.
hide cDNA Clones Consistent with the Transcript ( 12 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the
annotated transcript,
internally consistent
End(s) extend beyond
the annotated transcript,
internally consistent
cDNA Clones, End Sequence Only (ESTs)
Contained within the
annotated transcript,
internally consistent
End(s) extend beyond
the annotated transcript,
internally consistent
hide Sequence
GCATCAATCAATTCCCGCCACCGAGCTAAGATGCAACTTAATCTTGGAGC
GATTTTTCTGGCCCTGCTGGGTGTGATGGCCACGGCTACATCAGTGCTGG
CAGAGCCTCATCGTCACCAGGGACCCATTTTCGATACGAGGCCGTCGCCC
TTCAATCCTAACCAACCAAGACCGGGTCCAATTTATTAAATTGACAGTGG
GAAATTCACACTGCTGATGTCGTTAACACATTGATAAAATTAATACAATT
AAACCAAAACTGAACATC
hide Other Products of this Gene
Polypeptides
Derived from
THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0086518
52
 
hide Comments
  • Transcript terminates at site supported by polyadenylated cDNA.
hide External Crossreferences
RefSeq - An integrated, non-redundant set of sequences
hide Synonyms
CG8175-RA
 
Mtk-RA
 
hide References ( 2 )
FlyBase analysis
FlyBase Genome Annotators, 2004, Changes affecting gene model number or type in release 3.2 of the annotated D.melanogaster genome.
Changes affecting gene model number or type in release 3.2 of the annotated D.melanogaster genome. [FBrf0166453]
FlyBase, 1996-, FlyBase inference based on genome sequence analysis.
FlyBase inference based on genome sequence analysis. [FBrf0104946]