Open Close
General Information
Symbol
Dmel\Lap1-RA
Species
D. melanogaster
Annotation Symbol
CG10255-RA
FlyBase ID
FBtr0087407
Feature type
Associated gene
Evidence Rank
Length (nt)
4587
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GGCATTTACCAACACTAACACCTGCAAGCAACTTGTCATTTTCAAAGCGAAAAACATTAAATAAAACGCAATTGGATGGC
      AAAAATAAATATTACCCCCTCATGTTTGACATACAGCGTTTGAGTAAGCAATGAAATCATCTATTTGGGGACAGTAAATG
      CGAGAAAGAGCGAAAAGAGAGGCTCAGTCAGTCGCCTCTGTGTGTATGCGAGTGTGGGTGAGTGTGCCTGTGCGTGTTAG
      TGTTGGTGGGCAGAACAATAACAAGCCCAAAAATGCCAATGGACATGGAATGTAATGGAGCAGGACCAACAATAACGTTC
      CATCGGAGGCGATGAATCACAGCAGCCACAAACGTGCCTTAATTAACGAACGAAAAGCAATACACTTAATCCAAAGATGC
      CGCTGCTGAGCAAATGCTTCCCCTGCTTCAAATTCAAGCGCGAGGAGGTGATCGACAAGCTGGACTACAGTAATACCCCG
      CTAACGGATTTCCCAGAAGTTTGGCAGCACGAGCGAACCCTGGAGGAGCTTTACCTGAGCACCACAAGATTGCAAGCTCT
      GCCACCGCAATTGTTTTATTGCCAAGGATTAAGGGTGCTTCACGTAAACAGCAACAATTTGGAGAGCATTCCACAGGCCA
      TTGGCAGTCTGCGACAGCTGCAGCATCTGGATCTCAACCGGAATCTTATTGTCAATGTGCCCGAGGAAATCAAGTCCTGT
      AAGCACTTAACCCACTTGGACCTGAGCTGCAACAGTTTGCAACGTCTTCCCGATGCCATTACCTCGCTAATTTCGCTGCA
      GGAGCTGCTGCTAAACGAGACCTATCTAGAATTCCTACCAGCCAACTTTGGCCGATTGGTAAATCTGAGAATTCTGGAGC
      TGCGACTCAACAATCTCATGACACTTCCCAAATCCATGGTGAGACTAATCAACCTACAGAGGCTGGACATTGGCGGTAAT
      GAATTTACCGAGTTGCCCGAAGTTGTCGGCGAGTTGAAGTCCCTTCGCGAACTATGGATCGACTTCAATCAAATACGTCG
      TGTTTCGGCCAACATTGGAAAGCTACGCGATCTGCAGCACTTCGAGGCCAATGGCAACTTGCTGGACACTCTTCCCAGCG
      AGCTGAGCAACTGGCGCAATGTGGAGGTACTATCTATATGCTCCAACAGCCTGGAGGCCTTTCCCTTCAGCGTGGGCATG
      CTGAAGTCCCTGGTGACATTCAAGTGCGAGTCAAACGGTTTGACAGAGTTACCCGACAGCATAAGCTACTTGGAACAGCT
      CGAGGAACTAGTATTAAGCCACAACAAGCTTATACGCCTACCTAGCACAATTGGGATGTTGCGTAGCCTTCGCTTTCTGT
      TCGCCGATGATAATCAACTACGACAACTACCAGATGAGCTGTGCAGCTGTCAGCAGTTGAGTGTGCTAAGTGTGGCGAAC
      AATCAGTTGTCCGCTCTACCACAGAACATTGGAAACCTGAGCAAGATGAAGGTACTCAATGTGGTGAATAACTACATAAA
      TGCATTGCCAGTTTCGATGTTAAATCTGGTTAATCTCACATCGATGTGGCTAAGCGATAACCAATCGCAGCCCTTGGTGC
      CGCTGCAATATCTAGATGCAAGTACAAAGACCCAGTTGACCTGCTTCATGCTGCCCCAAGTCACATTCAAGATGAACAGT
      ATACAGGCCCAACAGCAGGCTCAGGAGCAGTATGAGTTCGTTTACGCCAACCAGCAGCAGCCTCACGCGAGTCCCTCGAG
      AAGGATTTGCTTCGCCGAGGAGGCCACCATTCTTAGCAACGCCAAAGCACAGCCAGCGCCCAATTATCCCAGCTTTGTGG
      CCGCTCCGCCGACGCCAACGCCCGATCAGATGGCTGGGTCTGTGCGGTTAATGCGTTCACCCACACCTTATCCCAAGGAG
      CTGCGACAAATGTCCAAATATGTGAGGCAGGCTCAGGCGGCGACCTCATCGGCCAATGCCAGCGAGGTAAGGGAGGCACG
      CGTAGTAACCAATGGACAAATTCACTGTGATAGCAACAATGCCAACCAGGATGTTGTGGACCAGGCCACAACAAGTGCAA
      TATACGGCATTGCGCCCGAAACGACACACATCTACGGAGTCTATCAGCAACCGCAGCAGATGGCGCACCCGGTGCCAACG
      CAGGAGTACTACGGCCTGCCACTGGTCAACTACGAAGCACACTATCAGCAGCTTTACGTCGAGGCCAACACGCCGCTTCC
      CACCACGCATTTAAACGGGGATCAGGACTATGAGTTGCAACCGCTGCAGCAACAACCAATGCAGCAACAGGCGCTGCCAA
      CACCCCGGTTGGAACCACCACCATACCACATAGCTCGAGTTTACACAAAGAAAACGCCCGAGGATCTCAACCTTTACGAG
      TCCATGAGGCAGCGAAAGCAGCAACAACAGCTGCAAGAACAAACCATCTACCAAGATGCTTTGAATAGCAATAGTAACTT
      TAAAACGACAGCGATTGGCGCTCAGGACGTCGAAGAGTCAGTCGATCAGTTGGACTACCAAAATAATATTAGCAATAATT
      TAGAGCCAAATCCGGAGGAGGAAGACCAGGAGCTGGATGACACTATGTCGCAGCACTCGCTTAATTCCACGGCCACTAAC
      AATACTTCCAAAGCGAGCCATAAGAAATCCACCTGGATCTTTGGTGTCCACAAAAATCCGACAGTCAAACAGGTTACTCT
      AAAATGGGAGAACTCTATAGGCTTTGATATAGCCGAGCTTCTTAATCAGGTTGGCATCTTTGTGAGCTCCATAACGCCCA
      ATACGAATGCCGCCCGCCTGCTTAATCTGAACGACAAGTTGCTGGAAATCGACGGCTACGACCTGACCAATGCCAACCTG
      AGCGATGCCAAACGAGTGCTGCTAAACTGCGGCACGGTCATGAACATAATGTTGTCGAGAAAATGATGGACCATCTATTT
      ACCGACCTAAGCCGATTCCCATCCCGAGACCGAAGACTTTTTGTGCATTTTTCTAACGCATTTTTCCAATAAGCAGCATC
      GCCGAAATCGGATAACAAATTACTTGGACCGATCATAGTGTTAGTTCATAATACCCTTCCGTACTGGCGGTCAAACCATC
      AGTCATAGAGCACAATCGCCAGCTAGAGGATCCCATGCTTTTTGTATATTAGATAGACGAATCCAAACTGCCATTTTCTT
      TGCACCTCCATACTCGATAGAAGAATATTACCAGAAGACGGCCAAATTTAGTAGTTATAGCCCACAACAAGTATTCTCAA
      AATTTAAGTTGAATGAAGATGAATTGAATTTATGATTTGACTTTAAAGCTGTTTATAATTCGAATTGAGCCACTTATAAG
      TTGGATTTATTTAATCAGTATCTAATCGATATCTTATGTAAATAGTTAAGTTATGCACTTAAGGAAGCAATAATATGTTT
      GGCCAATTATTAGTTCCAGTACTTTATTATTACAATGCGTAGATTACATTGAAGTGGCATTTGTATTGGAAGTTTGTGCT
      ACCATTATTCTGACCGCCAGTGGAATGTATCAGCATAATACATATAAATAGTGCAATTAGCGTCGATTATAGGTATATAT
      ATACGCACTCATTATATATACTCGCGATAATCAGACAAATTACCTTCAACTAGCGCCTATTTTACGCCCAGCGTTGTTCA
      AATTTGTTCCCAAAATTATATGTATAGATCAATTACTTGATTACAAAAGATATTTGCTGTTTATGTTAGTTGTTATGGTG
      CAGCAATACAAATTCTATATATATATATATTTACATATACGTACGCAATCTATATTTATTGTCCAATCGATCGAAGTGTC
      AAACATTATTTTCAATGGTGAACTGTTAGCACAAACTGAATTCTCACGCTATTGGCATTGTGATCAGTATTATTATTTAT
      CTGGTTAAACACGTGAAATCTAATCGAAAGATAAGCACTTCTATATTCATAGCCTTTATATATATATATAGTCATACATA
      GAGATGTGCATTATTGAAGAACACACGCCCACACACACACACAAACATACTGCATAAATACGAATCTAGCTAACTTAAGC
      AAGCGCACACATTTTGCCAATTCAATTTGATTTAAGAGCGTTACCACAAATCACTGAAATACAACATTCACTTTGTCATT
      TCGCCATAGTTTTTGATTAAATCTCATCCAGCCGCCGAAAGGGCCAAGTACAAAAACCATCTAGTCAACAGCCTGGCGGC
      CTTTTGATTAATGTCCCCGCCTGCTGCTGTCGTTATCGACAGGCAATTATCTATGAAAATTAATTGACGGCGACATTTGT
      AGTGTGCCATTTGGCCGACACCAGCGAAGCACGCAATCCAATCCCCCTGGAGAATCCGCTACATGCACCTCCTGCCACCG
      TGCTCCGCGGCTCCACTGGCTACGACATCATCAGCGACAGCGCCACCGAATGTTGTCTGTTGCGGCACTTTTGGCCACAT
      GTATTTGCATAAAAAGTGAACAACCAGCGGAATGGTCGTAAATTCAGCTGGAAAGTAGTGAACGAAAAAGCGCAACCGCG
      CACGATGGGCTGGAAAAGATAAATGGG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0303759
      3841
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0086538
      849
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0292771
      849
      Comments

      Extended 3' UTR based on RNA-Seq and/or EST data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG10255-RA
      Secondary FlyBase IDs
        References (2)