Open Close
General Information
Symbol
Dmel\Mdr49-RA
Species
D. melanogaster
Annotation Symbol
CG3879-RA
FlyBase ID
FBtr0087801
Feature type
Associated gene
Evidence Rank
Length (nt)
4240
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 69 )
Sequence
TCCAGTTCAGATCGCGCACTCGTCGGCTGCAGACGTCTTCTTGAGCACTTCCCAGTGCCAATAGAGCCAGAGGAAATATA
GATATATGTATATATATACATATATAAAGTCTTCAGACGATCGCGAGTTTCATCAGTTTGCCAAGTGTCCACGGAAGATC
GGCACGTGCTAAGCTTAATTGCTATAGCGAGTATAGAGATACTTTACTGCAGTATCGCCTCATAGACACAATGGTCAAGA
AGGAGGAATCACGGCTGCCACAAGCTGGTGACTTTCAGCTTAAGGAAGGATCAGTCGTGGATGCGACCCGAAAGTACAGT
TACTTTGATCTGTTCAGATACTCAACCAGATGCGAGCGCTTCCTGTTGGTAGTCAGTCTGCTGGTGGCCACCGCTGCGTC
CGCATTTATTCCCTACTTCATGATTATCTACGGAGAGTTCACATCCCTGCTCGTGGACCGAACAGTCGGCGTGGGCACAT
CCTCGCCAGCCTTTGCTCTGCCCATGTTTGGTGGCGGTCAGCAATTGACAAATGCCAGCAAAGAGGAGAACAACCAGGCG
ATCATTGATGATGCGACTGCCTTTGGCATTGGCAGTCTGGTGGGATCTGTGGCCATGTTCCTGCTCATCACACTGGCCAT
CGACTTGGCCAACCGGATAGCCCTCAACCAAATCGATCGCATCCGAAAGCTCTTCCTGGAGGCAATGCTGCGACAGGACA
TCGCCTGGTACGACACCAGTTCGGGCTCCAACTTCGCCAGCAAAATGACAGAAGACCTGGACAAACTGAAGGAAGGCATT
GGCGAGAAAATAGTGATTGTGGTATTCCTGATCATGACCTTTGTGATTGGAATAGTGTCTGCTTTCGTCTACGGATGGAA
GCTCACCCTGGTCGTTCTGAGTTGTGTGCCCTTCATCATTGCAGCCACCAGTGTGGTGGCTCGACTCCAGGGATCGCTGG
CCGAGAAGGAGCTGAAGTCCTACTCCGATGCAGCCAACGTGGTCGAGGAGGTATTCAGTGGAATTCGCACAGTGTTCGCA
TTCAGTGGTCAGGAGAAGGAAAAGGAACGCTTTGGCAAGCTGCTCATTCCCGCAGAGAATACGGGTCGCAAGAAGGGTCT
ATACTCGGGCATGGGAAACGCACTGTCCTGGCTGATCATCTACCTGTGCATGGCTCTTGCCATCTGGTATGGTGTGACGC
TCATTCTGGACGAGCGTGATCTTCCCGATCGCGTTTATACTCCGGCCGTTCTGGTCATTGTCCTGTTCGCCGTGATCATG
GGTGCCCAGAATCTCGGTTTTGCCTCTCCACACGTGGAAGCCATTGCTGTGGCCACGGCAGCTGGCCAGACCCTGTTCAA
CATCATCGATCGTCCGTCGCAGGTGGATCCAATGGACGAGAAGGGAAACAGGCCGGAGAATACCGCTGGACACATTCGTT
TCGAGGGCATACGCTTCCGTTACCCCGCCCGTCCGGATGTGGAGATCCTCAAGGGTCTGACCGTCGATGTGCTTCCGGGT
CAGACGGTGGCCTTCGTGGGCGCATCTGGGTGTGGCAAGAGCACCCTCATCCAACTGATGCAGCGGTTCTACGACCCCGA
AGCGGGCAGTGTCAAACTGGATGGACGGGATCTTCGAACACTGAATGTGGGCTGGTTGCGTTCGCAGATCGGAGTGGTGG
GCCAGGAACCGGTTCTCTTCGCCACCACCATTGGCGAGAATATCCGATACGGAAGACCATCGGCCACTCAGGCGGATATA
GAGAAGGCGGCGCGAGCGGCCAACTGTCATGATTTCATCACTCGCCTACCCAAGGGCTACGACACCCAGGTGGGCGAGAA
GGGCGCTCAGATTTCTGGTGGCCAGAAGCAGCGGATTGCCATTGCCCGGGCTTTGGTTCGACAGCCCCAAGTGCTTCTTC
TCGACGAGGCCACCTCTGCCCTGGATCCCACCTCTGAGAAGCGGGTGCAAAGTGCCCTAGAACTGGCCAGCCAGGGACCA
ACCACTCTAGTTGTGGCCCACCGACTGTCCACCATCACCAATGCCGACAAGATTGTCTTCCTCAAGGACGGTGTAGTGGC
GGAGCAGGGTACGCACGAGGAGCTCATGGAGCGACGTGGTCTCTACTGCGAACTGGTGAGCATCACCCAGCGGAAGGAGG
CCACGGAGGCGGACGAGGGAGCGGTTGCCGGGCGACCTCTGCAGAAGTCGCAGAACCTGTCTGACGAGGAAACCGATGAT
GACGAGGAAGATGAAGAGGAGGACGAAGAGCCGGAGCTGCAGACTTCGGGCAGCTCCAGGGACAGCGGATTCAGAGCCAG
CACGCGACGCAAGCGTCGCTCGCAGCGTCGCAAGAAGAAGAAGGACAAGGAAGTGGTATCCAAGGTGTCCTTCACTCAAC
TAATGAAGCTTAATTCTCCGGAGTGGCGTTTCATTGTCGTCGGAGGCATTGCATCCGTAATGCATGGCGCCACATTCCCG
CTTTGGGGTCTCTTCTTTGGCGACTTCTTTGGAATCCTCTCGGACGGTGACGATGACGTTGTGCGAGCCGAGGTCCTGAA
AATCTCCATGATCTTTGTGGGCATTGGCTTGATGGCCGGATTGGGCAACATGCTCCAGACCTACATGTTCACAACGGCCG
GCGTGAAGATGACAACGCGATTGCGTAAAAGGGCTTTTGGAACGATTATTGGTCAGGATATTGCCTACTTCGATGACGAG
CGAAATTCAGTGGGAGCACTGTGCTCCCGGCTGGCCAGCGATTGTTCCAACGTTCAGGGTGCAACCGGAGCTCGTGTGGG
CACAATGCTCCAGGCCGTGGCCACTCTTGTGGTTGGAATGGTCGTCGGTTTCGTTTTCTCCTGGCAACAGACGCTCCTCA
CACTGGTCACCCTGCCCCTGGTCTGTTTGTCCGTCTACTTGGAGGGCCGTTTTATCATGAAGAGCGCCCAGAAGGCTAAG
GCGTCGATCGAGGAGGCTTCTCAAGTGGCAGTCGAAGCTATTACCAATATCCGAACGGTCAATGGTCTTTGCCTAGAGCG
CCAGGTCTTGGATCAATACGTTCAGCAGATCGATCGCGTGGATATCGCCTGCAGGCGTAAGGTTCGCTTCCGTGGTCTGG
TTTTCGCTTTGGGACAGGCGGCTCCTTTCCTGGCTTACGGCATCTCCATGTACTATGGTGGTATTCTGGTGGCAGAGGAG
CGAATGAACTATGAGGACATCATCAAGGTGGCCGAGGCTCTGATCTTTGGCTCCTGGATGTTGGGACAGGCCCTGGCCTA
CGCGCCAAATGTAAACGATGCTATTCTGTCCGCCGGACGCCTAATGGATCTCTTCAAGCGCACCTCAACGCAGCCCAATC
CGCCACAGAGTCCCTACAATACAGTTGAGAAATCCGAGGGAGACATTGTCTATGAAAACGTGGGCTTCGAATATCCCACC
AGGAAGGGCACTCCCATTCTGCAGGGCCTAAATCTCACCATCAAGAAATCGACGACGGTTGCTCTGGTGGGTCCATCTGG
TTCCGGCAAGTCCACCTGCGTGCAACTGCTGCTTCGCTACTACGATCCCGTATCGGGATCCGTGAATCTGAGCGGAGTGC
CGAGCACGGAATTCCCGTTGGACACACTGCGCTCCAAGCTGGGCCTGGTCTCGCAGGAACCCGTGCTCTTCGATCGCACC
ATTGCCGAGAACATAGCTTATGGCAACAATTTCCGTGACGATGTGTCCATGCAGGAGATTATTGAGGCGGCCAAGAAGTC
GAATATCCACAACTTTATAAGTGCTTTGCCCCAAGGCTACGACACCCGACTGGGCAAGACATCGCAGCTCTCTGGAGGTC
AGAAGCAGCGCATCGCCATCGCTCGAGCCCTGGTTAGAAACCCGAAGATACTCATCCTGGACGAGGCCACCTCTGCGCTG
GACTTGGAGAGCGAGAAGGTGGTGCAACAGGCGCTGGATGAGGCGAGATCAGGCCGCACATGCCTGACGATTGCGCATCG
TCTGACCACCGTGCGGAATGCGGATCTCATCTGTGTGCTAAAACGCGGCGTGGTAGTGGAGCACGGCACCCACGATGAGT
TGATGGCACTGAACAAAATCTACGCCAATCTCTATCTGATGCAACAGGTGTCGGGCTAACACAGCGAACTGGAGTGATAA
TTGTTAGGCTTTAATTTAGTATGTACACTAGGCTAATTGAACATGTTGAAGTATTACAAAAAAAATAGAATGATTAGGCC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0302198
3624
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0086914
1302
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0291408
1101
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG3879-RA
Mdr49-RA
Secondary FlyBase IDs
    References (2)