Open Close
General Information
Symbol
Dmel\fdl-RC
Species
D. melanogaster
Annotation Symbol
CG8824-RC
FlyBase ID
FBtr0087946
Feature type
Associated gene
Evidence Rank
Length (nt)
3062
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 91 )
Sequence
TCGTACGGTCAGTTGCCGATTTTGTTTTTTGTTGTTTTTTTGCAATAAATGTTTGCCCAGCAGGAAAACTAACGACGCCA
ATGGCAAAAGCGGTCCGTGCATTTGTTTAATTACTGTCTGTACCGTACTCAAAATACTGGATGCCATGCAATACCGACCG
CATTACCGCTCCGCACCCGTTGTTCGTCGTCTTGCTCGCTCGCACTCCTGTGGTCGTGTGCACTTTGTGTGAATTACTCG
TACATTGCAGCACAAATAAGTCGATTGCCGAATACAAATATGTAAAAATGTAACGCCAGTCGCCGCACAGAAGTCGCAAA
AGCAATAGGACACACACGCCACATAGGCAGCCATTCGTTGGCGCACCTGCCAGTTGCACGCTTATCTGAACCGCACCAGC
AATACCCTAGAATCGCAGCAGTAGCTAGCCCCGCACCCCGCCCCATCCCTTCGGAGCGACCACAGTTGTCCTGCCGACGG
AGGAAATAAGGACATGCAAAGAGCATTTCCATACGCAGTGTGGCCTACGCTATCTCTATAAGATGTCCTTGGCTGTATCG
CTGCGCCGAGCTCTGTTGGTGCTGCTCACCGGCGCCATATTCATCCTGACGGTGCTCTACTGGAACCAAGGAGTCACCAA
GGCCCAGGCTTACAATGAGGCGCTGGAACGCCCCCACAGCCATCATGATGCTAGTGGCTTTCCCATACCCGTCGAGAAGT
CCTGGACGTACAAGTGCGAGAATGACCGATGCATGCGAGTGGGCCACCATGGTAAATCTGCCAAGAGGGTCTCGTTCATA
AGCTGTTCGATGACGTGCGGTGACGTTAACATTTGGCCGCACCCCACCCAGAAATTCCTGCTCAGCTCTCAGACGCACAG
CTTCTCCGTGGAGGATGTGCAACTGCACGTAGACACGGCGCATCGCGAAGTACGCAAGCAGCTCCAACTGGCTTTTGACT
GGTTCCTTAAGGATCTCAGGCTAATCCAGCGGCTGGACTACGTGGGTAGTTCATCAGAGCCGACCGTAAGCGAATCCTCT
TCGAAGTCACGCCACCACGCGGATTTGGAACCAGCTGCCACGCTCTTTGGAGCTACCTTTGGTGTAAAGAAGGCTGGGGA
TCTAACTAGCGTACAGGTTAAGATTAGCGTGCTCAAATCCGGGGATCTTAACTTTAGCCTGGACAATGACGAGACCTACC
AGCTTAGCACACAAACCGAAGGACACCGCCTGCAGGTTGAGATCATCGCAAATTCTTACTTCGGAGCCCGGCATGGTCTG
TCCACGCTACAGCAACTGATATGGTTTGACGACGAAGATCACCTTTTGCATACGTATGCCAATAGTAAGGTGAAGGATGC
GCCCAAGTTCCGGTATCGAGGCCTCATGCTGGACACCTCTCGCCACTTCTTCTCTGTGGAGTCCATCAAGCGTACGATTG
TGGGCATGGGCTTGGCCAAGATGAACCGCTTCCACTGGCACCTCACAGATGCCCAGAGTTTTCCCTACATTTCGCGCTAC
TATCCAGAGTTGGCCGTGCACGGAGCTTACTCGGAGAGCGAAACGTACTCGGAGCAAGATGTTCGGGAGGTGGCCGAGTT
CGCCAAGATCTATGGCGTTCAGGTCATACCCGAGATCGATGCGCCTGCACATGCGGGCAATGGCTGGGATTGGGGACCCA
AGCGCGGAATGGGCGAGCTGGCCATGTGCATCAACCAGCAGCCATGGAGCTTCTACTGTGGCGAACCGCCGTGCGGTCAG
CTGAATCCCAAGAATAACTATACCTACCTCATTCTGCAGCGCATCTACGAGGAGTTGTTGCAACACACGGGCCCCACAGA
CTTCTTCCACCTGGGCGGTGACGAGGTGAATCTTGATTGCTGGGCGCAATACTTCAACGATACAGATCTCCGCGGATTGT
GGTGCGATTTCATGCTCCAGGCTATGGCCAGACTAAAACTGGCCAACAATGGAGTGGCGCCCAAGCACGTGGCTGTCTGG
TCGAGCGCCCTGACCAACACAAAGTGTCTTCCAAACAGTCAATTCACCGTTCAAGTATGGGGCGGCAGCACCTGGCAGGA
GAACTACGATTTGCTAGACAACGGCTACAACGTAATCTTCTCGCACGTGGACGCCTGGTATTTGGACTGCGGCTTCGGTA
GCTGGCGGGCCACTGGGGATGCTGCCTGTGCTCCGTACCGCACATGGCAGAACGTCTACAAACACAGGCCGTGGGAGCGC
ATGCGATTGGATAAGAAGCGAAAGAAGCAGGTACTGGGTGGCGAAGTGTGCATGTGGACCGAGCAGGTTGACGAAAATCA
GTTGGACAACCGGCTGTGGCCCCGTACAGCCGCTCTGGCGGAGCGCTTGTGGACTGATCCTAGCGATGATCACGATATGG
ACATAGTACCGCCAGATGTTTTCCGTCGAATCTCACTGTTTCGAAATCGGCTCGTCGAACTGGGCATCCGAGCTGAAGCT
CTGTTTCCAAAATACTGTGCCCAGAATCCCGGCGAATGCATTTGATATTACCTCTAAGAAGTAAAAGTAATCTCCTACAA
ACCCAATCCCGCGATCCCTCCCAAAATGTGCGTTAGTTAGTTGATAGTCTAATTGTTATTTTATACGAATACCTAGGCTT
CGGTTTGCAAAGAAGCAGGCGACTGTTTGAAATGGTTTCTGGCATAAACCACGAATCGAATTTCGTTTTCATAGAACAAA
CATAAAACCACACCCATTACTAGTACAATCCATCTCGGAATATAGCGCACACAGGCATTGCAGTTGAAATAGAGAATGAT
TGGAAATGACCTAGTAGGGAATCACGTTGAGGTTGACATGCAGGTGACGTTGAACACTAGAGTTCATAGATATAGTTGTA
GATTTCATACGCATCAATTCACACAGACACAGACATAGGCTTACGATACATTTATATATTTAGATGATAAATCACGATTA
AGAAATGACAAATATTTTGATATTTTTAAAAGCTTTATTCGCAGAATATGAATTATTTAGTTTAGGGTGACATTAAATGA
TCTTTTCCTCTGCTTTTAATTT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0087947
2094
FBtr0339637
2854
FBtr0346633
3514
FBtr0474148
3062
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0087057
660
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0087058
673
FBpp0308699
672
FBpp0312213
660
FBpp0423147
664
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG8824-RC
Secondary FlyBase IDs
    References (2)