Open Close
General Information
Symbol
Dmel\Oda-RB
Species
D. melanogaster
Annotation Symbol
CG16747-RB
FlyBase ID
FBtr0088015
Feature type
Associated gene
Evidence Rank
Length (nt)
1909
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 152 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATCAGTTTGTTAGCAGCTTTTGCGACGTTCAGTTACCAATTGAGTTTTACTCTACACCATGTTGTGCGACCCAGTGTTTA
      GTAGTGGCTTCGTTAGAAGAGAATTTAATGACAGCGGAATTGCCGACGGCAAGCTCCGCACCATCTCGACTTCGTCTTGC
      GCCACGACCATGTCCTCGGAGTCCTACCGCATCTCTCTCGGCGTAGGGCCTCTGTGGTGGTCCTGATGTCCCTGTCCACC
      ACAGAACAGATCACGATAGGGCATCGCTCTTGACGGGCTACAGCCGTAAGTCTTCGGTCGACTCGGCTGGTGGCAGCCTG
      TACGAGGCCAGCTCCCGGGCGTCGTCGTTGTCGTCCTCCCAGTCGGATTGCTCCGACTTGGAGTCGCAGCCCGACATCCA
      CTCGCTGTGCTCGGACGATGACTGCCAGGAAGTGCTGCGCCAGATCTTGCAGCACGACCAGCCGGTGCAGATCACCATCA
      AGCTGCATGTCACCGAGGACCAGTACACCAATTGGAATACGATTCTGAACCCAGTCAACAACTTGTTGTATGTCGCTCTA
      CCGAAGGACCTTCCTCCGGCCGGCTCCAAGCAGACCTTCATCTCGCTTCTGGAGTTCGCCGAGGAGAAGCTGGAGGTGGA
      CGGCATCGTTATGGTAATGCCTAAAGATCAGCCGGATCGAGCTCGCCTCATCGAGGCGTTCCTCTTCATGGGCTTCGAGC
      CGCTGTCCAGGAAGGCACCGCAGGCACCGCCGGCTGCCATTAACGACAACGAGAACTACTACTTCCTCTACAGCATCGAG
      GAGTAGTTCGTCGGCAAGGGGACGATTTTCGCCACAGAAACGAAACAAAGAAGAAGTAATATCAGTAGCAATCCAATATT
      CTGTTTCGTAGTTTCCGCAAATAACTTTTATTAGCCAGCCGTAGATACAATGACATATTGAGCTCAATATGTGTTCAGTG
      AAAATCAGCAAATCAATCCTTTTTGAATCTTCGCGTTGTTTATGTAGTCGAAAATCGTTTTGAAAATTGTCTTCGGAGCG
      GCTTCATTTTTGGTAGACTTTCAATTATGGCCAGCCACGTTAAGAGCCTGATCGCAAATTACTATATTAAACTATATCCA
      ACAACAACAAAAATCGAACGAAAACGTAAAAAAAAGTAGAAAACTAAAAAATGTCAAAAAAAAAACAAAACAAAACAAAG
      GAATGTATTAATCCTAAGTTTATTCGTGAATCAATATTTTTTATTTATGTTTTCATGTCTAATCAACATATATATTTTCT
      TCATGTTTTTTCTATATATTTTATGTTTAAGCTTATATATGAAGTATTGTAATCCCAATTTGTTCGCACTTAAAAATATT
      CAATATATTTTTATTCACTTTTTGTACGCCGAAAGCGACGAGAACGGCGAGGTAGAAGTTTTGAAGGATAGAAAGGGAAA
      CGCATATGCATAGAAGCTAATTACATAGATCAGCAAAAAGGATCCACATACACGCTATATCCAATATTAATAAACTTATT
      AATCAATAGATTCCACACCGCAAGCAAGCAAGCGAAAGCAGTTCTTTTATTTATACCACTTTGTATGTATCATTTTCTTG
      ATTCCAATAATAAAACATATGACTTAACAAAATTATTGAATTGTCGGCCGGATTATTAAATTATTTCGTTTACGACGCTC
      GCGTTTAGTGCGCATTATTATTGTTTATTGAAAGTATCTCGAGTGGAACTTGGTCGAGACTTATGATTAAATTTATACAC
      CCAATTGCCTCACCTTCCTTTCGCAGATAAGAGAGATTTTATATGTATTTCGTCTACTGTTTAAAAAGTGACCCAATACG
      ATTGTTAGAGATAAGTCTGCACAGTTTGTCACTTGAAGATAAGTAGTTATTGGAAAAACGGGGGCTCCT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0088013
      1736
      FBtr0088014
      1471
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0087123
      248
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0087121
      254
      FBpp0087122
      270
      Comments

      Translational frameshifting postulated (FBrf0100578 and GB:AF038597): +1 frameshift reflected in aa sequence of predicted polypeptide.

      Extended 3' UTR based on RNA-Seq and/or EST data.

      translation_exception: transcript_with_translational_frameshift

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (4)
      Reported As
      Symbol Synonym
      CG16747-RB
      guf:1-RB
      guf:2-RB
      Secondary FlyBase IDs
        References (2)