Open Close
General Information
Symbol
Dmel\Mppe-RB
Species
D. melanogaster
Annotation Symbol
CG8889-RB
FlyBase ID
FBtr0088025
Feature type
Associated gene
Evidence Rank
Length (nt)
1763
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 58 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AAACAGCTGTAGCGTTGCCACATAGCCGTCGCGGCGCAAGAAGTGCAAACATAGGATAAAGATAATTGCACAATTATTGG
        CACCTGGAGCCGGCAAACGCTGTAACGGAATTGCCCGCGTTCAAAAGCCAATGGCGCGCATTGGCGAAACATCGGAGGAA
        TGTGGTAATGGACGCAACACAACGTTCCGGCCGTTCTAGATGTTTTGCTTTCTAATCCAATTAAGCGTGTGCGCCCTGAA
        AGCGATGATGCGGGCCGGTTGTGGTCAGATGTGCGCCGTCCGTTGCAGCAGCTCTACATTCCCGAAAATATGAGCATTCT
        TACGTAAATATTGCATGGGCAGTGCGTATTTAAATATAGATTGTACATATAGAGACGCAATGTAAGCCAGTTGCATTTGC
        CAGAGGACAACCGAAAGTATTAATCAAGCAATCCAAACCGATGCGGCATAGCCGGGATTATGGCTTCCTTGCGCGTCGTC
        AATAGAAACAGATTAGTGTGCCGCGGTTTTGTGGCTCTTACGTTGCTGCTGGTCTTCTTCAACGAGTTTATAGTTTACTA
        CATGGCCCAGTCCAGTTGGCAGCCAATCGATTGCAAACTAGATAATTGCACGCGCCTGCTGCTTATTGCTGATCCCCAGA
        TACTGGGAAACTCCTACGATCGATCTTCGCACAGTCCTTTAGCCAGGTACGATTCGGATAGATACCTGGCGAAGACTTTC
        GAGCGAGCTCTTGCCTTTACACAGCCTCACATCATAGTGTTCCTGGGCGATCTGTTGGACGAAGGCAACATTGCCACGGC
        TCAAGAGTACAAGCAGTACGTTCAGCGGTTCAGACGAATTTATCAGAATAAGAACTACAAAAAACGCGTCCATGTGCCGG
        GTGACAATGATATTGGCGGCGAGAATGGCGACTACATATCCAACTCGAACCAAAGACGCTTTGAGAACGAATTCATGAGT
        GAAGACCTCTTTGACTATGACAATCGATTACGCTTCTTCAAGATAAACCGCATGCTATTGGACTTTAGCAACCCGGATAG
        GGATAACAATGCGGATCGTCTAAGAATTGGCGTATCCCATGCCCCGCTGCTCATTGGCGGAGGACCCCTGTTGAGAGCCA
        TCATCAGCGACTTGGATCCACATATCATTTTCTCAGGACACTGGCATGAATCCAGAATATTTATTTACCCCTCCACCAAG
        GTGATCAACTTTTATGAAAACTCCGTGAGGCATTTTGACTTGAAGGCCCTCAAAGAGCAGGAGCACAGCTATCTGGAGAT
        AATGGTGCCCACTTGCTCGTATCGCATGGGAAAGTCCAAGATCGGATTGGGCTACGCGGTTTTGGAAAACTACAATCTGA
        GCTACACGGTGCTGTGGCAGCCAAATCGATTTATCCTGCTCTTCACCTATGTTTTTTGGGGACTATTCGTCGTCTGTGGT
        TTCGTCGTCTTTAAGATGATGACACGTTGTCCCTTCCGCGTGGCCAAAAGGCAGACGCTCTATAACCGCGTCTCGACTAT
        ACCGCAATTTTAGACTGCACTTTCCACTCGTCATGGACAATAAGCCCAAGATTCTCAAGAATTGCTCGAATATACAACTC
        AAAATTGAATTAAAATCGTATTTATAGACAAGTAGCTTATATTCGGATAAAGTTGAGTAGTAGCAATGAAAATTGATATA
        AAGTGCTAAATTTGTTTTCCAATAAGTGAAAAAATGTAACCAATGTCCTCCATCCATATTCATTAAAAAATTTAATTTAA
        TTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0088024
        1757
        FBtr0339582
        1784
        FBtr0339583
        1790
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0087132
        357
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0087131
        355
        FBpp0308657
        364
        FBpp0308658
        366
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG8889-RB
        Mppe-RB
        Secondary FlyBase IDs
          References (2)