Open Close
General Information
Symbol
Dmel\tou-RB
Species
D. melanogaster
Annotation Symbol
CG10897-RB
FlyBase ID
FBtr0088094
Feature type
Associated gene
Evidence Rank
Length (nt)
2291
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 26 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TGGAGTTATATTTTTATATATATGCAACAAAAAACAAGTCCAGCAAAAAGAAGAGCAGCGCCAAAAAGCAGGCAACTCCC
      TCGAAGAAACAGCAGCAGAAGAAAAACAAAAAGGAGCAGCAGTTGACCCCCAATGGAAAAGAGAGCAAGAGCAAGAGCGC
      AATCAATAAGCCAGAAAACCAGGCTCCGCTGAGCATCAAAATCAACCTTAAGGCTCTGGCCCAAAACGGGCAGTGTTTGC
      TGAAAACTAAAACACCACCAATCCTAACCAAATCCCCAACCGCATCCCCATCCTCCCATCCAAACACTAGCGACTCCGAC
      TCGGACTTTGGCAAACGGACGAAGAAGAAGAGCGGCGGCAAACGCAGACGCTCGGCCAACAATACAAACTCTAGCAAATA
      TTCCAATTCCTTACAGAATTGCCAGTTCTGCACGTCCGGCGAAAACGAGGACAAGTTGCTACTGTGCGACGGCTGTGACA
      AGGGCTATCACACCTATTGCTTCAAGCCCAAGATGGACAACATTCCCGATGGCGATTGGTACTGCTACGAGTGCGTGAAC
      AAGGCCACCAATGAGCGCAAGTGCATCGTTTGCGGCGGTCATCGTCCGTCGCCCGTGGGGAAGATGATCTACTGTGACTT
      GTGTCCTCGTGCCTACCACGCCGATTGCTATATACCGCCGCTGCTAAAGGTACCGCGTGGCAAGTGGTACTGCCACGGTT
      GCATCTCCCGGGCGCCTCCGCCGAAGAAAAGAAGTGCAGGTGGAACATCCGGCAGCAGCAGCAAATCTAGGAGGGACAGG
      GATAGGGAGTCGGGCGGATCGGCCAAGCGGCGTAGCGACAACAGCAAGACACCAGCCATGGAGCACATGCAGCAGCAGCA
      GATGCCACTGGCAGGCGGGGATTCCCACCATCATCATCATCAGCAGCCGCCGTCGCTGAACTCCTCGCACGATGAGTCGA
      TGAATTCTCTGCCGGCGGCTCCTCTGAGGTGAGTGTGGGGGCCTGCGGGCGGCTGAATGGGCGGCGGAGTACACGGTCCG
      GGTTCCAGTTAAATAATGCCTCTGCTCTCTGCAGTCCGGCGCACTCGGTGGTCTCGGCCACGAACTACGATGACCAGCAC
      CATGCCAACAACTCGGTCGATGGCAGCAGTCGCTTCCACGCGCATCTCATTCCCCCGTCAAATAATGGCACTGCGGCTCT
      GCTGGAAGATGTGCCGGGTGGCGCCAATGTGATGCCCGGCGTCTATCCAGTTTATACGCCAGTTGCGGCTGGCAACTTCT
      CAGCCGGATTGATTAACCAAGCGCCGGTGCAGCCAGCGATGCCGTTTGCCAACGTGGTCGCCATGTCGCCACGGGCTGTC
      ACGCCCACCCGCACCCGAACGCCCACACCGACGCCAGCACCCACTCCGCCACCACCACCGCCGACACCGCTGCTAATGCA
      GGCCTCGCCCACAGCCACCGCCCTCCATGTAAACGCCTGCCAGTCACCGCCCCAACAACAGCATGCGCAGCTGATGACCA
      TGCCCTCGCCACCAGCCATTGGAGTCGGAACGGCCACTAACCAAATGTCGCCACCGCCCATCAACATACATGCCATTCAG
      GAAGCCAAGGAGAAGCTGAAGCAGGAGAAGAAGGAGAAGCACGCCACCAAGAAGCTCATGAAGGAGCTGGCTGTCTGCAA
      GACGCTATTGGGGGAAATGGAGCTTCATGAGGACTCGTGGCCATTTCTTTTGCCAGTAAACACCAAGCAGTTTCCCACAT
      ATCGAAAAATAATCAAAACTCCCATGGACTTGTCCACAATCAAAAAGAAATTGCAAGATTTGAGCTACAAAACCCGTGAG
      GACTTCTGCGTGGACGTGCGTCAGATCTTCGATAATTGCGAGATGTTTAACGAGGACGATTCGCCCGTTGGCAAGGCAGG
      CCACGGCATGCGCAAGTTCTTCGAGTCCCGCTGGGGTGAACTGACTGACAAGCACTCCTGATCCTGCACCACTAGCCAGC
      CACAGATCCAGATGGCTACCAGCACCAGCAGCACGATCACCATTGGCACCACCGTCACACCGAACAACATGGCCGTCACA
      GCAACGCATCCCATTGAAATGGTCACCCTGGTCGCGGCAACGCAGGAGGATGAGGAGGCAGCCGTGGAGACGACAACAGC
      ATTAACTGAAGCAGCACAATTTTGGTCAAGAGATTAGTTTAGATTAAGCAGAGATTGTACATAAATGGGAGGAATGAGGA
      GAGGGTCGAGAAGCACAGCATACACATTAATATATATATATATATATTTAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0088091
      10470
      FBtr0113066
      10866
      FBtr0333070
      11743
      FBtr0333071
      10721
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0087196
      249
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0087193
      2999
      FBpp0111979
      3131
      FBpp0305283
      3058
      FBpp0305284
      3094
      Comments

      Based on cDNA(s) that contain premature stop codon and/or downstream start; may or may not produce functional polypeptide.

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG10897-RB
      Secondary FlyBase IDs
        References (2)