Open Close
General Information
Symbol
Dmel\RanBPM-RA
Species
D. melanogaster
Annotation Symbol
CG42236-RA
FlyBase ID
FBtr0088263
Feature type
Associated gene
Evidence Rank
Length (nt)
4370
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 44 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CATCGGCTTTTGTTCCAGCTCTATAGCATAAAGTCAAAACTTCGTAGATTTAACAACTCATAGCAATCGTTTGAAGCCTC
        CTTTTGCAACCACAACAAGATAAACAACAACGACAACTCAACCATAACATGGAGAACGTCGAAGAGGCCCCGCCACTCTC
        TTCGGAGAGCAACAGCAATAGCAACAACAGCAGCGCCAGCAGCAGCTCTCACCAGCTCTCTCAATCGGGAGCCATGGGTG
        CCGAAATAGCCCCCTCTACGTCTCGGTCACACTCTCATTCGCCCACACCCTCGCCGCCCGTCCCCGCGTCCTCTCACGAC
        CAACCCCATCCCGATCACCCTAGTCCCCCATTGAATGCATCTGAAACGGAAGCTCGCGAGAATTCACCACATGATCACTC
        ACCCACTCCTACTTTCCACCAGACTGCACCGCCACCCACGACTTCATCGACGGCACCGCAGCGGGACGAGCGGGAGCAGC
        AGCAGCAGCAAGAGGCGCCACCATTGCAGCAGGATCAGCAGGAGAATTCGCCCGCGCAGGACCAGGAGCTGCACCCATTG
        CTGGATCAACAGAATCAAGAATATCCCGCAGTGCACCAAGATCAACAAGCGGAGCAAAACCAGGAGCTGCATCACATAGA
        GGGGCTTATTCGGCACCGAGAATCACAGAATCCGGAAGAGCATCCACCACAAGCATCGCTGGAAAACCGGGAGACATTAG
        GACGAGAAGATACCAACCAAGAACCGGATGAGCCGCAAGTTCGAGATCCCGAAATCGAACCAGAAGCCGAGCCACCGCCA
        CCGCTGCTTCTCGAAGATCTGGACGAGCAGGACTCCGGATCGCAGGATCTTAACGAACAGCAGCCGCCACTGATTATAGA
        CGCAAACGCTATAGCCGAGACCATAGACGCCAACGCCGTGGAGCGCATCGACGACTACGAAGACGACGACGAGGAGGTGG
        ATGAAGAGGAGGAGGTGGTAGAGGACCGGGTCGACAGAGCCGGCGAAGTCGCTTCCGTTTCCGGTGCCCAGCGCCTGCAC
        TCGGTGGCCGTTTTGCCGCGCTACTCCTCAGCCTCACGAGCCCCAAGGAGCAGCAACAATAACAACAACAATATCAGCAA
        TCACAACAACAATAATAACAACAGCAACAGTAACAGCCTCTCGCGACGCACTCGTCACTTCTACAGCAACAACGGCAGTC
        ACTTCAGCAACGACATGTTCCCCAGCCACAATCCCCGCAGCAGCACCCAGACATCATCGCCGCGGGTCGGTGGTCGCCGC
        CATCACTCGACCCCCGCCGCCAGCTCCAATTCGCCACAGCACCAGGGCGTGGATCCCCTAAGGCTGCTCTATCCCAATGT
        CAACGAGAGCGAGACTCCGCTGCCCAGGTGCTGGAGTCCCCATGACAAGTGCTTGTCCATCGGTTTGTCGCAGAACAACT
        TGAGGGTCACCTACAAGGGTGTGGGCAAGCAGCACAGTGATGCCGCCTCAGTGCGCACTGCCTATCCGATCCCGTCCTCC
        TGCGGACTGTACTACTTCGAGGTGCGGATAATCTCCAAGGGACGCAACGGCTACATGGGCATTGGCCTAACTGCCCAGCA
        GTTCCGTATGAACCGCCTGCCAGGTTGGGACAAACAGTCGTACGGGTACCACGGCGACGATGGCAACTCGTTTAGCTCCT
        CGGGAAATGGCCAAACCTACGGCCCCACTTTTACCACCGGCGATGTGATTGGATGCTGCGTCAACTTTGTGAACAACACG
        TGCTTCTACACCAAGAACGGAGTGGATCTGGGCATCGCATTTAGGGATTTGCCGACTAAGCTTTATCCCACTGTGGGCCT
        ACAGACGCCTGGCGAGGAAGTGGATGCCAACTTTGGTCAGGAACCATTCAAGTTCGACAAGATCGTCGATATGATGAAGG
        AGATGCGCTCCAATGTGCTCCGCAAGATCGATCGATATCCACATCTGCTGGAGACCCCAGAAAACCTGATGAATCGCCTG
        GTTTCCACTTATTTGGTGCATAATGCGTTCAGCAAAACCGCCGAGGCCTTCAATGGCTACACAAATCAGACTTTCAACGA
        GGACTTGGCATCGATCAAGACACGTCAAAAGATCATTAAGCTTATACTGACTGGCAAAATGAGCCAGGCCATCGAACATA
        CACTACGTTCTTTCCCCGGACTCCTGGAAAATAATAAAAACCTCTGGTTCGCATTGAAGTGCCGCCAGTTCATTGAGATG
        ATCAATGGAGCTGACATTGAGAACGTGAACAACAAAGTCACCGCCACCACACAGACCATGCCCACAAACCAGACGTCAGT
        GATACAGTCCACCAAGACGTTCAAGCACAGCAAGAGCGGCAGTGGAAATGGCAACGTCAACATAAATCAGACTCAACAAC
        AGAACAACACTGCGATTCCAGCTGTGATAAAGCCACAAGGCGGCGATAGGCCAGATATAAAAAACATGTTGGTTGACGAC
        AACTCCAACAAGTGCGTGGAGCACGACAGCAACAGCATGGACGTAGAAATGGAGCCCTGCCAGAGTCACTCCAACGGCGG
        CGACTCGAGCTCCAATGGCAATGCCAGCGCAGTGCGCAACTCTCTAGATGCCATCGACGAGGAAATGGATGTTTCCCCCT
        CATCGCGTAACTGTGGTCGTGTGATCGAGAAGATCCTTGAGTTCGGCAAGGAACTGTCCAGCATGGGCCAGCAGCTGGAG
        AAGGAGAACCTAATGACTGAAGAGGAGCGTCAAATGTTGGAGGATGCATTTAGTCTGATTGCCTACTCTAATCCTTGGTC
        CAGTCCGCTGGGCTGGTTGCTGTGTCCCTCGCGACGTGAGAGTGTTTCCACCACACTCAACTCGGCCATATTGGAGTCCC
        TGAACTTCGAGCGTCGTCCGCCGCTGGAATACCTGGTGGCTCACGCCTCGGAGCTGATCAAGGTGATCGGACAGCACTCG
        CTGGGCGAGGACGCTTTCATTACCATCGACGATGTGTTCCCGCAAAATTGACCCAGTTCCCCGACGCTGCTGAAGATGTT
        CGAGACCACGCTGACCCTGCCGCGAACCAGTGTGCTTACGGAACCGTTGGGCAGCGCCGGAACCGGATCTGGGCCCTCCA
        CATCAACGGCTGCCGTGGCAGTTCAGACCAGCAAACGACGCCGAAGGCGGCGTAACAAACGTCGCCGCAAATCCTCCCTG
        TCCAGCAATACCGATGCCCCGTCGTCGCGGACCTACGATCCCGTGATGACGGGCAGTACGCTCCGGTCGGCAGCTGTGGC
        ATCGGTGGGCGGGGGCACGGGCACGGGACCAGTGCGTCGGGGTCGTCGCAGGAGCGGGGTCAGCTCATCTTCATCGGCGG
        CAGCGGCTGCAGCAGCGGCAGCGGAGGAGGAGGCGGAAGAAGCGGAAGCGGAGGCGGCTCGCCAGGAGGAGGAGGAAGCG
        GAAATCTTGAGCGGAAACAGCAGCCCATCGATGTTCGTCGATCCGCAGGACTTCTTCGAGACACTGGACTAAATTTAGAT
        TATTTACAATTTGCAGTAGGTTAAATTTTGTTGTTACTTCCGTTCTCTTTCTTTTTTACCTGCGCAACCGGCTTCAGTGC
        GCCTATTTAAAACTAATCGCCGTTCTTTTAATTGTTCGATTATGCTAAAGATGCTATGCGTTTGGCGGCCTTTGATTTGG
        CGTGATTTTTAATAACTTTTAACATATATTTTATATAGCCTCTCTAAGCATAAAGTGTGTAATATTATGATGTATAATTA
        AATTTGCGAAATGTGCTGCGACACGACCCTTGAAATTGAATTAGCCCTTTGTTTTTCGCTTCCACCGCCCGAAACACAAC
        AATCACACACCAAAATATAATCTAGAATTGATAGTGAAGGGACTAGCCTGGAGCAAAAGCTGTTCAATCATCTCCTTAGC
        ATGTTAATATAGAACCGAATCCATAGTTAACTGGTAGACATTCGCGTTTTAATTCTCCGTGTTTTCAGCGATTTTCGATG
        GACTCCGCGCCATCCCGTGTCTTGTGGCAAGACTAAGCAAAAGCAAATGAACATTTTAAGTGTAATGTTTCGCTATAGTG
        TTTAAGCGTATTAAAATTTAATCTATATATACAAGATTGGTCATACACACATTCGGCAAACATGAATAGAATTTAACTGG
        ATAATCGTTTAAATATATTGTATGGATGTGTATTTCAGGAAAGCGAGAACTGTGTTTTAAAGGGGGTTCAAATTGGATTA
        AATATATGCCATTCTGACAATGTGTTCAGTTTTATATATTAAAATTGTATCTTTTCAAATGTCATGATTTGTTGATTAAG
        CTGAAGTTTTCAACAAATAAAAATAAAAATGAAAGCACATTCAAATTACC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0088262
        3855
        FBtr0100460
        4372
        FBtr0306247
        4369
        FBtr0330614
        3617
        FBtr0346961
        4370
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0087358
        960
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0087357
        598
        FBpp0099887
        962
        FBpp0297357
        961
        FBpp0303464
        770
        FBpp0312425
        1127
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (4)
        Reported As
        Symbol Synonym
        CG11763-RA
        CG42236-RA
        RanBPM-RA
        Secondary FlyBase IDs
          References (2)