Open Close
General Information
Symbol
Dmel\CG11883-RA
Species
D. melanogaster
Annotation Symbol
CG11883-RA
FlyBase ID
FBtr0088284
Feature type
Associated gene
Evidence Rank
Length (nt)
2789
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 17 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CCAGTCAAAGTTCTGCTTCCCATGTGAACGGTGGTATTTTGTATTCCGCGTTCCGATCGTCTGCACCGATTCCTTTCGCT
          ACGCAGAAGATTTTTTACCAAGAAAAGAAAAAACTTCGCAGACTCAGCCCTTTTCGCTGGCTTCAGAAACAAACTTGGTT
          TTGGAAAAGTAATTTTTTGCTGGCATCCCACACAACGAACGACCCGAAAATCAGTTGCTGGGCAACCCCTACTAAAATAA
          GGAAAATCGAAACGGGAGGAGGACCCACGGAAACTTACACGCAAGCTTCCATTGAAGTGCGAGACGCCGGCACACGAACT
          TTGTCGATGCTGCAGAGCAGCAACCCCAACTTTCGATCCCTGGACCTATCTCTGGGCACGCCCACACCAACCACACCCAC
          CTCCAGCGAAATTCCAGCTGCTCCAGCCAGTGCCACCGCCTCGTTGAGTGGCTCAACGCTGCAATTTGGACCAGAGGAAC
          CAGAGGAAGGTTCAGCTGCCGGAGGAAGCCAATCGCTGACGCCACTTGATGCCAGGGAACTCCTGACGAGACCCACACGC
          GCCTACGCCTCCGTCAGCCAACCACAAAGTCCAAGACATCGGGGATCGGGGTGCGGGTCCGTTTCCGGATCACGAATAAT
          CACACACGGCCTGACCGGACGCTCCACATCGATATCCTCGCAGCTGGAGAAGACCAAGAAGCTACTGAAAATGACCGAGG
          GCGAGGACAAGCCACTGACCATTCTGCACTACAACGATGTCTACAATATTGAGTCTATGGCGGAAACGGAACCCGTTGGA
          GGTGCGGCCAGATTTGCCACGGCCATCAAGAGTTTCGCGCATCTTAATCCGCTCGTGCTCTTCAGCGGTGATGCCTTCTC
          GCCGAGTATGTTGAGCACCTTTACCCAAGGAGAACAGATGATTCCTGTGCTCAATACGGTGGGAACTCACTGTGCCGTCT
          TTGGCAACCACGATTTTGATCACGGCTTGGATGTGCTGGTCAAACTGATCAAACAGACAGAATTCCCCTGGCTCATGTCC
          AATGTGGTGGACAATGAAACCGGTCGTCCATTGGGTGGTGGCAAGATCTCGCACTTCATACTACACAATCAGATATCCAT
          TGGCTTGATTGGACTGGTGGAGCGAGAATGGTTGGAGACTCTGCCCACCATCGATCCGAATGAGGTGACCTACATTGATT
          ACGTGGAGGCGGGAAATAAGCTTGCCCGCGAGCTGAGAAACGAGGGATGTGACCTCATCATTGCCCTTACCCACATGCGT
          ACTCCCAACGATATTAATCTGGCCGAGAAATGCAACGGCATCGATATTATACTCGGTGGTCACGATCACGTCCGCGAGGT
          CACCGAAATCAATGGCAAAATGATTGTCAAATCAGGCACGGACTTCCAGCAATTCTCCGTCATCACTATCGAGCGGGATG
          CCGCCAATCGTGAACATTTCACAACGGACGTCAAGTGCTTCGATGTGACGGCCAAAATTCCGGAGGATCCGGAACTGAAA
          CAGGAGCTCTCCAAATATGCCAAGTTCATCGAGAGCAAGCTTTCGGATGTCATGGGTGTCTTTAGCGTGGAATTGGATGG
          CCGTTTTTCCCGCGTACGAACCCAGGAAACAAATCTGGGCAACTGGGTGTGCGACGTGGTGCTTGCCGCCGTTGGCGCCG
          ATGTGGTCATCCTGAATGGTGGCACCTTCCGTTCGGATCGAGTGCATCCGGTGGGTGCCTTTACCATGGGCGATCTGGTG
          AACGTTATTCCCATGCGTGACCCACTAATCCTGCTCGAAGTGAAGGGTAAAATACTCTGGCAAGCACTGGAGAACGGAGT
          GTCTGCCTATCCCAAGCTGGAGGGCAGGTTCCCCCAGGTGTCGGGCATCAGTTTCGCCTTCGATCCGCAGGCGGAGCCTG
          GCAAACGTATTGATCCGCAACTTATCCAGGTGGGCGATGAGTACCTTAACCTGGAGCAATCATACAAGTTGTGCGTCAAG
          AGTTATATCTTCATGGGCTGTGATGGCTACACCATGTTCAAGGATGCAACTGTGCTGATGGATGATGATGCTTGCCCGGA
          GTTGGGAATAACTCTGCAGAACCATTTCAAGGCCATCAATTCGAGGAAGTGTGGACAAAACACTAAGCACCGCCAGTCGC
          TGGTGACCCTTTCCCGGAGGCATAGTCTGGTGCAGTGCCTGGATAGTATGGATCTGGATGGACCATCGCCCATTCGCAAA
          TTGTCCGTGGGCCATCACAACAAGTCGATGGATTTGACACATGGAAATTCTCAAAAGATGTTACGACGTGCGTCCTTGGA
          TGACCTGGAGCAGTCCACATGCGATTTGGCGCCACAACTGGAGCACCGTATCGTTATGATTCAAAACGAAGAACATCATC
          GACAGTTACTGTTCAAAAAGGAGACGCACATAATGAATTCCACAATCACCGAAGCTGAGGACGATTACAAGAAAATAAGA
          CAAATTGATTTAGGGACAGGTTCCGATGTGGAGAGAAACATTTGAGTACGGTTTAGGCAAAAGCAAAGCGAAGATATAAC
          CATTTAGCTAGTTAGATAGTTGGCAGATCTGTGGGATCGTGTCCTATATTATTACCGTTTATTGTTAATGCTCCACTGTT
          TTTTTCGGCTAAGTTTCGTTGTGAACGTTTGTAAGACTTCCCCAGAGATATTGATATTGATATTGTATATGATGCATGTG
          TAGTGAGTACGTGTACCTAAAGCTTACCGCTAGTTTAATTTACTTTTAATTAGATAAACTGATTTACAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0088283
          2870
          FBtr0113063
          2866
          FBtr0339461
          3895
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0087376
          732
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0087375
          713
          FBpp0111976
          792
          FBpp0308547
          792
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG11883-RA
          Secondary FlyBase IDs
            References (2)