Open Close
General Information
Symbol
Dmel\CG2269-RA
Species
D. melanogaster
Annotation Symbol
CG2269-RA
FlyBase ID
FBtr0088408
Feature type
Associated gene
Evidence Rank
Length (nt)
3379
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 66 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CTGGCGACACTCTTGGTTCCGCCTTGGCTGAGCACAGAGATTTAGTAGTTCAATTTGGTGTCAGAGTGAAAGAAGGAAAG
        CAGCCAGCGAGGTAATGGCAGCAATGGCCAACCGATTTGTAGGCCCCAGTGGTGCCATGTTGGTGCTGCTGGCGGTGGTG
        CAGTGCATCCTAGCGACACCACAGCGCACCGCCGCCTTTTCGCTGCAGGCGGCCGTGGATGAACTGCATCGTCGGGAGGC
        GGCCAAGTATCCACTGAACGCCCCTCCGCAGCCAGCTCTCGACGACTGGGATGAAGATGGATCCGCTCCTTCGGCTTTCC
        GCGAGCGTGAAATCCAGCCACTGAACGCTGAGCCCGCTCACAATGAGCTCACGGAGCAGTTTCTGCGCGAAATCGAAGAG
        GCCAGGGATCGGGATGCAGTGCGTCAATGGTGGCGCCACCTGGACCAGGCGAAAACCCAACAGGAACCGGAACAGGAAGT
        CGAGCAGTTCGAGCAAAAGAAGCGGATGCGAGTGCCGCCTTACTACTTGCTCATGCAAAAGAAGCGCTCCTATCCGGTTC
        TGCCATGGTTGCCATACAACGGTGATAAGAGGAAACGCTTCCCTGTGGCCAAGAGGAGCACCACCAACTCCAATCCGGAA
        TCTCCATTGGGCAGAACCGATGAGCGGGTGGCCCAGGAGCTGAGCGAACTGTTCGGCAAGCCCGGAGAATCGCAATCACA
        TAACGAGGAGAAACGCAAGCGGTCGGCGGATGAGCAGACAAAGGTCACGACCAATCTTCCTGAATCCCCGCCAGCCACCG
        CCACCGCCTTGGGGGATATGCGGCTGGAGATCAACTTTCAGCGGGTGAATGTTACGCCCAAGGAGACGCCCACATCCGCT
        CCAGCTGGCGCTGGTGAATTGGTCCAGCATGGCGGCCATGCCGGTCATCATGGTGGCCATGTGCCTGGAATGTCACCCGA
        GTATCGTCATCGCAAGCGAAGTGATCATGCGCATGGCGAGAACGCCGAGGATACGGAGGCGGACGAGCATGATGAGGAGG
        GTGAGGAGAGCTCCGATGAGGATGACCACGACGAGTTTGACGAGGAGGACGGTGAAGCTGACCTGGAGACCGAGGAAGTC
        GATGAGCAGCGGCGCAAGAAGAAACGAGCTGCTGCCAGTCTATCTGGAAATGGTGGAGGCAATAAGCACATTCATGCACC
        CACTGTGGGTCACCTGATGCTCCGTGCCAAGAAGTCCATAGATTGGTCACAATACTTCGGTCTGGATCGCAAAAAGAAGT
        CCTTGCAGAAGAAAGAAAACCTAAAGAAACGCAGCGACACGGATAGTAGCACCAATAATGATGAGGAAGATGACGAAGAT
        GACAGCTCCGAGGCGGAGAAAAAGAAGCGTGACTTCGATGCCGAAAAGCTGGACAGCATGGACAAGAAGCTGCAGTCCAT
        CGAGGACTTCATCATCGACGAGACCATCAAGTATACGGGTGCACACGAGGGACTCAACAGCAAGGACGACATCCGCAGAA
        TCAAGGACCATGTCCTCTCGCGCTTGGCAACCGCTTACAGTCTGGAGAAAATGCGCAGGGCTCTGGATAAGTTAAGGAGA
        TCAGTGGACAACGAGAGTCACCTGATGCGCAATACCATCGAACCGGAATCCGAGGAGAACGCGTTGGACTCCAATTACTG
        GTTGAACAAAAAGTCGGTGAAGAAGGAGCAGGCAGATCAACTGGCAGAAGACTCGAGACCACCCAAGGACATGGAAAAGA
        GGAAGCGCAGTGGTTACTTGCGCTATCCGGAGCAGCCAAATACCATGGAGGAGGCACTCAGCCTGGGCAGCGCTCCCTAC
        GAGACCCTAAACGACGCCTATCTGGGCAACAAGAACTACATTGTGGGCTCCAACCAGTGCCCCATTATCGAGTCCATGGC
        GGAGCGCTGTCGGGGCGTCGATCTCATCTCCGGAGACATTAACCAGGAGCTCCTGCCCCTCTGCGGTGTTCACCAGATAT
        GCTATCTATGTGGTGCCTCACAGGTAGCCTGCGACTATCAGTACTTGGCGGAGGCGGATAGCGTTTGCGGCGACAGCAAC
        GACTGCCAGTCGGCGGCCCGTTCCATCCTGATGATCCTGCGGGGATCACACGGCCGGCAGCTGGGTCCTAGGGAGTGCTT
        GAAGAATCCCTGCTTGTACAGGGCCATGCGGGAGATTGGGCTTTAAGCGAACTGCTCCGAATTGCCGCCCAGTGTTTTCC
        TAACGTCTCTTTTGTGTGCGTTTAAAAAGAAAATCATAAATCGAAAATGAAAATGACAACCCCGCAATGCAAAGCAGAGA
        GAGAGAGAGAGAGAAGATAACAATATGAGCCCAAAAAACCAATATAAAAACCTTGCTGAACTGGCAAAAATCAAACAAAC
        GATTGATTCAAAACCAAATAGTCGTCGCATACAATGACATAATATTTTGATGGATTTTCCTGACCGCCTCGCGAGGCGGC
        AGCAGCCAACTAGAGTTTACCAGATACCTAAAGAGATGCATATAGATATACATACAATTTGGATTCAGTTAATCGCAGTA
        GACGCCCGATGCGGCCCGATTTATTTGGTTTAAGTGTTCAGCGTAAAATGGAATTTTTCGAAACATATTTGCACGTTTTA
        TGGGTGTTTAAGTGTACAAACGTGATCATAGACGAAACATAACACACATACATATGCTTAACCAAGACATACAAGTATTT
        AATCCACAGCCAGCTTTTTAAGTAACTCAACTCGCTTGACATTCTAAGCAAAATGAAAGGCAGAGCTCACATTGGCAGCT
        AGTCCTCCAAAGTCACCGTCAGAATTCTTCTATTCGGTTTGACTTGGATGTGTGCACATACATACGTGCGTGTGCCATAC
        CATAATACACTATACACATTATACATATATAACGATTTTAGCCTACACCGGGAAAAAAACTATGTATCTTTGCGAACGCC
        AAATGCAGAGCAACTAACTATAGTATCTGAGACTTCTCTCTCCGCATTACTTGTCTACAGATGAACATATACATTAATGT
        GTTTCAACGTGCTTACAATAAATGGACATAACTAAGACAAATATTTGAAGCTCTAACAAATCTATAGATGTGATTATTAA
        TATATACAAGGAGTTTAATAAATGTGTAAATCTTTTAGGGCCAGCATATATACCAATCTGAACAACAGCAAGACGTTTGG
        TTGCGAAATCAAAATATTATTAATGTATTTACATAAACGAACAAATATATATATTTAAACTTGATGTATATGCTACAGTT
        TGAAAAACAAAACAAAACAGAACAAAAACCCATATTTGAAAATATTTATTGCTATACAGTTATCATAAATGTCGAATATA
        AATATATCGGGAATATCCC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0088409
        3783
        FBtr0088407
        3543
        FBtr0305653
        3834
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0087496
        703
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0087497
        783
        FBpp0087495
        703
        FBpp0296933
        783
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG2269-RA
        Secondary FlyBase IDs
          References (2)