Open Close
General Information
Symbol
Dmel\wun-RA
Species
D. melanogaster
Annotation Symbol
CG8804-RA
FlyBase ID
FBtr0088553
Feature type
Associated gene
Evidence Rank
Length (nt)
1626
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 97 )
Sequence
ATAATGAGTACCGAAACGTCGGCGAGCGAGACAACACCGCTGCGGCGGTCGGAAAACGAAACACCTGACCATAAAGAACT
GGCCCAAAGTAACAGCAACAGTCGACAAACAACAGTTAATAGCAACAACAATAACTACAGTAACTCGGTGCAAGTGCGTC
TGCAGGAACAGGACAGAGATAGCGACAGCGAGCAACAACAACATACTGCCACCATCACCATGGATACCAACAAAAGAATC
CTCTGCCGCGTGGGCTTGGATGTTTTAATCTTGCTCTGCGCTGGATTTCCCATACTGCTGTTTTTCCTGCTGGGCGAGCC
GTACAAGCGGGGCTTCTTCTGCGATGACGAGTCACTGAAGCACCCGTTCCACGATTCTACGGTCCGGAATTGGATGCTAT
ACTTCATCGGAGCTGTGATACCAGTCGGCGTGATATTCATCGTGGAGGTCATCATTTCACAGAACAAGGCCAAGCAGGAT
AATGGCAATGCAACCAGTCGAAGGTACGTCTTTATGAACTACGAACTGCCCGACTGGATGATCGAGTGCTACAAGAAGAT
CGGCATCTATGCCTTCGGCGCTGTGCTCAGCCAGCTGACCACGGATATAGCCAAGTACTCCATCGGCCGACTGCGTCCCC
ATTTCATCGCGGTGTGCCAGCCTCAAATGGCCGACGGCAGCACCTGCGACGATGCGATCAATGCGGGAAAATACATCCAG
GAGTTCACATGCAAGGGAGTTGGATCGTCGGCGCGCATGCTCAAAGAGATGCGCCTCTCCTTCCCCAGTGGCCACTCCAG
CTTCACCTTCTTCGCCATGGTCTATCTGGCGCTCTACCTGCAGGCTCGCATGACCTGGCGGGGCTCCAAGCTGCTGCGTC
ACCTTCTCCAGTTCCTGTTCATCATGGTGGCCTGGTACACAGCCCTAAGTCGCGTATCGGACTACAAGCACCACTGGTCC
GATGTGCTGGCAGGATCGCTTATTGGCTCCATAAGCGCACTGGTCGTGGCCAACTATGTCTCCGACTTGTTTCAAAAGCC
CAACACGAAGCCCTATTTGGCGCGTACAGTGCAAGACATGAATGCATCGCCGGCCCAGGCCATAACGATTACTACAAACT
AACACGCAGAAGTGCAAAATAGCAATTACAAGTTGCACGAGCTGTAGTTAAACTAAGGACTCGATGTTCTTACGGCTTTC
TTCATGGGGACAGTGAAGCCTAGCTTTGCGAGCCTTCCCAATTAATTTATTCCTGTACTGGCATTTTAAGAGCTGAGCGT
GAATGTATGTGTTAGCTGCAAGTGCACTCGAGTGCCTTCTTTAATATTTAAACTAGAGCAATTGAGAGATCTGTGTATGA
CGATAGCTATACTAAATATTTTTAACTGACGCAACAATTTCCACAAAACAAGTGACCTTTAAAACAGAGCTGCGCAAAAA
ATATATGAAAGCAATAAGTATTATGTAAACTAGTTTTAAGCTTTGGATACGGAAAGATAATTAAAATATTTCTAAGATGG
CCGTTAAATATGTTAATTTATAATTTTTGGCGAGAATTTACAATTGTTCGCTGAATATTTTTATGAAAATAAAATAGAAT
TAAGAATATGGTTTTGTTATTTGTAG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0088552
2026
FBtr0306111
1563
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0087636
300
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0087635
379
FBpp0297248
364
Comments

Transcript terminates at site supported by polyadenylated cDNA.

Downstream translation start supported by comparative analysis across Drosophila species.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Secondary FlyBase IDs
    References (2)