Open Close
General Information
Symbol
Dmel\CG8026-RB
Species
D. melanogaster
Annotation Symbol
CG8026-RB
FlyBase ID
FBtr0088611
Feature type
Associated gene
Evidence Rank
Length (nt)
2926
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 76 )
Sequence
AAAGTCGATTAGTCGTTTTTCGTTGGAGAGCTTGCTGTTCGCATTTATCCGCCTGCTCGCGCGTAGAAAAGTTGTTACTT
AATGTTCATTGCTGCCACACGTGCTTGATTATTAATTGCAGTGCGCTAATCAGTCGCTTGTCAGCTGAGCAGACCACAAA
AAACGAAGGCAATTATTTAGGCTGCCCTTTCAGTTCGGCATTACATAAGAAACGAATGGCCAAACGAAAATAATTTTGAA
ACAATTTCGGAGTTAATATTGCATCAGCAATTCTGAACAGCAGATACACAAAAAGGGCAGCAATTTGGCCAACAAAGTCT
TCATAAACGACAACAAACGAGTGAAAATATGAGCTGGGCAACAACAAAGCAAAGGCACAAATGTTTCAACTGTAGCAGCG
GCAGCAACAAAAACAACCGGAGCAGCGGCAGCAGCAGCAACAACAACAACTGTGCGCCTAGCAACAAGATAATTTCGACG
AGCGATTTCCTTTGATTTGCGCCCATCTGTGTCGAAAGCAGCCGAAAAGCCAAAGAGTGTAAATAGCACGTAGTTTTAGT
ACAATTCACTGTAGCAAAAGTGAGTTTCAACCGGGGCAGCCAATAAGCCTGCGATAGCAACAATAATACAGAACGAGCGC
AAAAGAAATCACCAGAGATTGCACAATATGAATCCGATCAAGGCACAGTCAACGGGCAGTCCCAAGAAATTCAACGTATT
CGCACACGTCAAGTACGAGCATTTGGTTGCCGGAGTATCCGGCGGAGTGGTGTCCACACTCATTCTACATCCCCTGGATT
TGATCAAGATTCGATTCGCAGTTAACGATGGCCGGACAGCTACGGTGCCGCAATACCGGGGACTGAGCAGCGCCTTCACC
ACGATTTTCCGGCAAGAGGGCTTCCGCGGACTCTACAAAGGCGTCACCCCCAATGTCTGGGGATCGGGCTCCTCTTGGGG
CCTGTACTTCATGTTCTACAACACCATTAAGACATTTATCCAAGGAGGAAACACGACCATGCCATTGGGCCCCACAATGA
ACATGCTTGCAGCTGCTGAGTCGGGAATTCTCACCCTGCTGCTGACCAACCCCATCTGGGTGGTGAAGACGCGTCTCTGC
CTGCAGTGCGATGCCGCGAGTAGTGCCGAGTACAGGGGCATGATCCACGCCTTGGGCCAGATATACAAGGAGGAGGGAAT
CCGTGGCCTGTACCGCGGCTTTGTTCCCGGCATGTTGGGCGTCTCCCACGGAGCCATCCAGTTCATGACCTACGAGGAGC
TGAAGAACGCCTACAACGAATATCGCAAACTGCCCATCGACACGAAGCTGGCCACCACCGAGTACTTGGCCTTCGCGGCT
GTCTCCAAGCTGATCGCAGCGGCGGCCACCTACCCGTACCAGGTGGTCCGGGCACGGCTGCAGGACCACCATCACCGATA
CAACGGCACCTGGGACTGCATCAAACAGACTTGGAGGTACGAGCGCATGCGAGGTTTCTATAAGGGCCTGGTGCCCTACC
TGGTCCACGTCACGCCCAACATCTGCATGGTCATGCTGATCTGGGAGAAGCTGACCAGCTAGATGGAGTATTAGTACTAG
ATCATCGAATCTGGAATCTGACAGAGAATTTAAGCTAAGCACCTAGAATACACGAATCTTTCTCGTTTCCTCCGATGTGC
AGCTAACAGCAGAAAATGACAAACTTATTCTGTATTATTGTTGTAACTCGATTTCGGTTTAGCCCTAGCACCTTACTTTA
GCCTTAAGTGTATTCCATATCTAGTTTATTGTACATCCTTCACTCCCAACTTCGAAAGTAACTGATGTGATCGGGGCGTC
GTCAAAATAGCCCCTGCCCATGAAATGTAATTTCAAAAACGCATTTCTTGCACTCTTCATCAAAACAAACACATATTTAG
TTCTTAGTTTAGTTAAATTATTTATTCTATAACGGCTTGGAATTGTGTAAGCACAAAGAAAAACCAGTTACTGTTTAGTT
GATACAAAATTTCGTTTTGGCAAAAAGATTCTTCATAGTTTTTGAAAATGGTTTATAATTTTAAGGATAAACCTTGACAT
TTATGTAAATAAGCATAAACGCATTGTGAAACCAACTTAGTCCTACAGTGGAACAATCTTATTGAAATCAAAGAAAAGAT
AAGAAATGCGAAATTACTTACCCATATTAAAAGGCCACGATGGCAGACCTAAATGAAAACCAAGAAACAAACTAAAGCAA
ACACTGTCAGCGCGTCCAGCCTGCGTCTTTTCATTTGTCCAAGGGCTCATGGCAGCTTGAGTAAGTAGTCCTTGCTCCTT
CCGCTCCCTAAGTCTTCGATCACCCCCTTAATTGTGCAGAATCTCTTTGCTAATCTGAAACAGCCAATGCGCCCTTACTG
TAAGTAGATGTAGCTTTCAGTTCTCAGTCTCTAACCGCATTGTGTTTGGTTCTCTTTGCAGGTTTGAGGGCTACAGAGGC
TTCTACAAGGGGCTGAAGGCGAGTTTAACCCGAGTAGTGCCTGCCTGCATGGTCACCTTTCTGGTGTACGAGAACGTCTC
GCATTTCCTGCTCGCCAGGCGGAAGCGAATTGAGACTAAAGAGGATGCGTCGGACGTGTGATTTTCCTTTGGTTGGATTC
CTTTTAGGCTTCTAAGATACATATATCACCTCACGACATTTCCATATGTCTCTATAGTCAGCGGGCAGTTGCAATCGTGC
TGAGCATGCGCAGCTGCTTTTAGTTTAAGTTTAGTTAGTTGTTGCGAAGACTTATTTGGTCTTTTCGTAGTAAGTAAAGT
GATTGTTGTTCCTAAGTGTGGATCAGAATGGATTTGTGATTGAATTCAGACGAAAGTGTTACAATATACCTGTGAAATAT
AAGTCCATAGCCTCACTCTTGCAAATAAACCAAATCTTTGTGAGCC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0302511
1489
FBtr0302512
1941
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0087692
304
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0291673
203
FBpp0291674
322
Comments

Transcript terminates at site supported by polyadenylated cDNA.

Dicistronic transcript; alternative monocistronic transcript(s) exist.

transcript_exception: dicistronic_mRNA

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG8026-RB
Secondary FlyBase IDs
    References (2)