Open Close
General Information
Symbol
Dmel\ACC-RB
Species
D. melanogaster
Annotation Symbol
CG11198-RB
FlyBase ID
FBtr0088872
Feature type
Associated gene
Evidence Rank
Length (nt)
7833
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 45 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CAGTTGAGTTCCAATCGTCGGTCACTGCAGTAGCCATCTAGAAATCGTGCGGAACCAGTCAGTCTAGGAAGTTCAAACCG
        ATCCTACACGGTCTACTACAATCCGATCCGATCCGGTCCGACCTCGTCTTCGAAACTGCCATCACAAGCTAAACAAGGGC
        ACACGCAGAGTGACAACTCCAGCGTGATTGCAGCTACAGCAACGGCAACAACCACCAGCAGCAAGCCTCCTATTGCTCCA
        GCAGCACCTCCTTCGGCGGTAAAAGCGAGTGACAAGCGATTCCCCAAGGCGTGCATCAAGAAGGTCCAGTTCTCCAGCGA
        GAGCCTCCGGTCCGACGTGGATGAGCTGTGCGACCAGCTGAAGGATAGCGCACTCAGCAATCTGAGCAACGACAACATTC
        GCATTGCCTGCCACCAGAACAACAACAACAGCAGCATCAACAAGAACCAGAACAACAACAGCATCGACATCAGCATCAGC
        ATCAGCAAGATGAGCGAAACAAATGAGTCCAATGACACGGCCGCCCAATCCGCCGAGGGCGAGCGGCCCAGCTTTTTGGT
        GGGTGATGAGATCGACGAGCGGGCCGCCGAGGCGGGCGAGGCATGTGACGAGTTCCCCCTGAAGATGCAGAACGATGTCC
        GCCAGAATGGCGATATTTCCGAGCGGCGCAAGCGGTTAAGGCCGAGTATGTCGCGTGGCACAGGGCTGGGCCAGGACCGG
        CACCAGGATCGCGACTTCCACATCGCAACCACCGAGGAGTTCGTGAAGCGCTTTGGCGGCACCCGAGTGATCAACAAGGT
        CCTGATTGCCAACAACGGTATCGCGGCCGTCAAGTGCATGCGATCCATCCGGAGATGGGCGTACGAAATGTTTAAGAACG
        AGCGGGCCATTAGGTTTGTGGTGATGGTCACTCCGGAGGATCTAAAGGCGAATGCCGAATACATCAAGATGGCGGATCAC
        TATGTGCCCGTGCCCGGCGGATCGAACAACAACAACTACGCCAATGTCGAGCTCATCGTGGACATTGCTCTTCGCACCCA
        AGTGCAGGCCGTGTGGGCTGGTTGGGGTCATGCCTCCGAGAACCCGAAGCTGCCGGAGCTGCTTCACAAAGAGGGTCTGG
        TGTTCCTTGGCCCTCCGGAACGTGCCATGTGGGCGCTGGGCGACAAGGTGGCCTCCTCTATTGTGGCCCAAACGGCCGAG
        ATTCCCACCCTGCCGTGGTCCGGTTCGGACCTGAAGGCCCAGTACAGTGGCAAAAAGATCAAGATTTCCAGTGAGCTCTT
        CGCCCGAGGTTGTGTGACCAATGTGGAACAGGGTCTGGCCGCAGTTAACAAGATTGGCTTCCCCGTAATGATCAAGGCCT
        CGGAAGGAGGTGGTGGCAAGGGTATTCGCCGCGTGGACACCACTGAGGAGTTCCCCGGCCTGTTCCGCCAGGTTCAAGCT
        GAGGTGCCCGGCTCACCGATTTTCGTGATGAAGCTGGCCCGCGGAGCTCGCCACTTGGAGGTGCAACTGTTGGCAGATCA
        GTACGGCAATGCCATTAGCTTGTTCGGCCGTGACTGCTCCATCCAGCGTCGTCATCAGAAAATTATTGAGGAAGCTCCTG
        CCATCGTGGCCCAGCCAGAGGTGTTCGAGGACATGGAGAAGGCCGCCGTGCGGTTGGCCAAGATGGTGGGTTACGTCAGC
        GCGGGAACCGTGGAGTACCTATATGATCCGGAGGGTCGCTACTTCTTCCTGGAGCTGAACCCACGTTTGCAGGTGGAGCA
        TCCGTGTACGGAGATGGTGGCCGATGTAAATCTTCCAGCTGCTCAGCTGCAGATTGGAATGGGAATTCCCCTTTACCGGC
        TCAAGGACATCCGTCTGCTGTACGGAGAGTCTCCCTGGGGCTCCTCAGTCATTGACTTCGAAAATCCACCGAACAAACCG
        CGTCCCTCCGGACATGTTATCGCTGCTCGTATCACCTCAGAGAACCCCGACGAGGGCTTTAAGCCCAGTTCTGGAACCGT
        TCAGGAGCTTAACTTCCGGTCGAGCAAAAATGTGTGGGGCTACTTCAGTGTGGCTGCCAGTGGAGGATTGCACGAGTTCG
        CGGATTCACAGTTTGGGCATTGTTTCTCCTGGGGCGAGAACCGTCAACAGGCTCGAGAGAACCTGGTGATTGCCCTGAAG
        GAGCTGTCAATTCGAGGTGATTTCCGAACCACAGTGGAATACTTGATCACTCTGCTCGAAACGAATCGGTTCCTCGACAA
        CAGCATCGACACCGCCTGGCTAGATGCCTTGATCGCAGAGCGTGTGCAATCCGAGAAGCCGGATATCCTGTTGGGCGTAA
        TGTGCGGATCGCTGCACATCGCAGATCGTCAAATTACTGAGAGCTTTTCCAGCTTCCAAACCTCTCTGGAGAAAGGTCAG
        ATCCAAGCAGCGAACACGCTGACGAACGTGGTGGATGTTGAGCTAATCAACGATGGCATCCGTTACAAGGTGCAGGCCGC
        CAAGAGCGGAGCCAACTCGTACTTCCTGCTGATGAACAGCTCGTTTAAGGAGATCGAGGTGCACCGCCTCTCCGACGGAG
        GCTTGCTCATCTCTTTGGAGGGCGCCTCCTACACCACGTACATGAAGGAGGAGGTGGATCGCTACCGCATTGTGATTGGC
        AACCAGACATGTGTCTTTGAAAAGGAGAACGATCCATCGCTGTTGCGCAGTCCGTCTGCGGGAAAGCTCATCAACATGAT
        TGTGGAAGATGGCGCTCATGTAAGCAAGGGCCAGGCCTATGCTGAGATTGAGGTGATGAAGATGGTGATGACCCTGACGT
        CCCAGGAGGCAGGCACAGTGACATTTGTGCGTCGACCAGGAGCTGTTCTAGATGCAGGATCCCTTTTGGGCCACTTGGAG
        CTGGACGATCCATCGCTGGTGACGAAAGCGCAGCCCTTCAAGGGACAGTTCCTGCAGCCAGAGAACGCACCGGTACCCGA
        GAAACTAAACAGGGTGCACAATACTTACAAGAGTATCCTTGAAAACACACTGGCTGGTTACTGCCTGCCAGAACCGTTCA
        ATGCACAGCGACTCAGAGACATCATCGAAAAATTCATGCAAAGCTTGCGTGATCCCTCGTTGCCGTTGTTGGAGCTGCAA
        GAAGTTATCGCCTCCATCTCTGGTCGCATACCCATATCCGTGGAGAAGAAGATCCGGAAACTGATGACGCTGTACGAGCG
        AAACATAACTAGTGTCCTGGCCCAATTCCCCTCGCAGCAGATCGCCAGTGTTATTGACAGCCATGCGGCCACGCTGCAGA
        AGCGCGCTGACCGTGATGTCTTCTTCCTGACCACCCAGAGCATTGTGCAGCTGGTGCAGCGCTATAGGAACGGAATCCGC
        GGCAGAATGAAGGCCGCCGTTCATGAGCTGTTGCGTCAGTACTACGATGTAGAGTCGCAGTTCCAGTATGGACACTACGA
        CAAATGCGTGGGACTGGTGCGAGAGCACAACAAGGACGACATGCAGACGGTGGTCAACACCATCTTCTCGCACTCTCAGG
        TGGCCAAGAAGAATCTGCTGGTCACTCTGCTCATTGATCACCTGTGGGCCAACGAACCTGGACTAACGGACGAATTGGCC
        AACACGCTAAGTGAATTGACCTCTTTGAATCGAGCTGAGCACTCTAGGGTTGCCCTGCGGTCCCGCCAAGTTCTGATCGC
        TGCCCACCAGCCGGCTTATGAGCTGCGCCACAACCAAATGGAGTCGATCTTTCTCTCCGCCGTTGACATGTACGGTCATG
        ACTTCCACCCCGAGAACCTGCAGCGCCTGATTCTGTCGGAGACCTCAATCTTTGACATCCTGCACGACTTCTTCTACCAC
        TCTAACCGGGCAGTGTGCAATGCTGCTCTGGAAGTCTATGTGAGGAGAGCTTACACATCCTATGAGCTGACCTGCTTGCA
        GCATTTGGAACTCTCCGGTGGCCTGCCGCTGGTGCACTTCCAGTTCCTCCTCCCCACAGCTCACCCGAACAGACTGTTCT
        CGCGCATGTCCTCCCCCGATGGATTGGATCAGGCAGCGGCAGAGTCTTTGGGAAACTCATTCGTGCGCACCGGAGCGATT
        GCAGCCTTTGACTCCTTCGAACACTTTGAGATGTACTCGGACGAGATTCTGGATCTGCTCGAAGACTTCGTCTCGCCAGC
        CATGGTTAATGCCAAGGTCCTGGAAGCCGTAGAGGCAGCGGATTCTATCTCGGACAGCCGACACAGCACCTCGATCAATG
        TGTCGTTGTCGGATCCCGTAACCCGGGCGAATGCTGCCGAGGAGGCCAAGTCCACCGAACCGATTCACATTGTTAGTGTG
        GCTGTGAGAGAAACGGGGGAGTTGGATGACCTGCAAATGGCCCAAATCTTTGGAAATTATTGCCAAGAGCATAACGAGGA
        GCTCTTCCAGCGACGCATTCGTAGGATTACATTTGCTGCTCTGAAGAAGCGGCAATTCCCCAAGTTCTTTACGTTCAGAG
        CCAGAGATAAGTTCACGGAGGATCGTATTTACCGGCATCTGGAGCCAGCATCTGCTTTCCATCTGGAGCTGAACCGCATG
        AAGACGTACGATCTGGAGGCTCTGCCCACGGCTAACCAAAAGATGCACCTGTACCTTGGCAAGGCCAAGGTTTCGAAAGG
        TCAAGAGGTCACGGACTACCGCTTCTTCATTCGCTCGATCATCCGTCATTCGGATCTGATTACCAAGGAAGCCTCTTTCG
        AGTATCTGCAAAACGAAGGAGAGCGTGTGCTCCTGGAGGCCATGGATGAGCTGGAGGTGGCATTCTCGCATCCGCACGCC
        AAACGCACGGACTGCAACCACATCTTCCTGAACTTTGTGCCCACCGTCATCATGGATCCGGCTAAGATCGAGGAATCTGT
        AACAAAGATGATTATGCGATATGGTCCACGTCTTTGGAAGCTGCGTGTACTGCAGGCTGAGCTCAAGATGGTCATCCGCC
        AGTCACCACAGTCACCCACTCAGGCAGTGCGTCTGTGCATTGCAAATGACTCCGGCTACTTCCTGGATATTTCGATGTAT
        ACCGAACAAACAGAACCAGAGACAGGAATCATTAAGTTTAAGGCCTACGGTGAGAAGCAGGGATCTCTGCACGGACATCC
        CATTTCGACGCCCTACATGACCAAGGACTTCCTGCAGCAGAAACGTTTCCAGGCGCAGTCCAATGGTACCACCTATGTCT
        ATGATGTGCCCGACATGTTCCGCCAGATGACCGAGCGTCACTGGAGAGAATTCTCCAAGGCTCGTCCCACCGTGGACATT
        CGCACTCCCGACAAGATTTTGATCGAGTGCAAGGAGCTGGTCCTCGAGGGCGACAACCTTGTAGAGATGCAGCGTCTGCC
        CGGCGAAAACAATTGCGGCATGGTGGCTTGGCGCATTGTCTTGGCTACTCCGGAATATCCGAATGGCCGCGAGATCATTG
        TTATAGCCAACGATCTCACCTACTTGATTGGTTCCTTTGGAATTAAGGAGGACGTTCTCTTTGCCAAGGCTTCCCAATTG
        GCTCGCCAACTCAAAGTACCGAGGATATACATCTCCGTTAACAGCGGTGCCCGCATAGGACTTGCTGAGGAGGTTAAAGC
        TATGTTCAAGATCGCATGGGAGGATCCAGAGGAGCCAGATAAGGGCTTCAAGTACCTCTACTTGAGCACCGAGGACTACG
        CCCAGGTGGCCAACCTGAACTCGGTGAGGGCTATCCTGATCGAGGACGAGGGCGAGCAGCGTTACAAGATTACCGACATC
        ATCGGCAAGGACGATGGTCTGGGCGTGGAGAATCTGCGTTACGCCGGCTTGATTGCCGGTGAAACGTCGCAGGCCTACGA
        GGAGATTGTTACTATCGCTATGGTTACCTGCCGTACCATTGGCATTGGATCCTATGTGGTGCGCCTGGGTCAGCGCGTTA
        TCCAGATCGATAATTCACACATTATACTCACTGGCTATGCTGCGCTTAACAAGCTGCTTGGACGCAAGGTGTATGCCTCT
        AATAATCAGTTGGGTGGCACACAGATCATGTTTAACAACGGAGTCACCCACAAAACAGAGGCCATCGACTTGGACGGTGT
        CTACACCATCCTCGACTGGCTCTCGTACATCCCCGCGTACATCGGTTGTGACCTGCCCATTGTTTTGCCCAACGATCGTA
        TCGAACGCCCTGTCGACTTCATGCCCACCAAGTCGCCCTACGATCCGCGCTGGATGCTGGGTGGCCGTGTGAATCCCGTG
        AACGCTAATGACTGGGAGAACGGATTCTTTGATCGCGACTCGTGGAGCGAAATCATGGCCTCGTGGGCCAAGACAGTGGT
        CACTGGTCGCGCACGTCTAGGCGGTGTCCCCGTGGGCGTAATAGCCGTTGAGACCCGCACCGTAGAAGTGGAGATGCCCG
        CCGATCCTGCCAATCTCGATTCGGAAGCCAAGACCCTGCAGCAGGCAGGTCAGGTGTGGTACCCCGACTCCTCGTACAAA
        ACGGCACAAGCGATCAAAGATTTTGGACGAGAGGAGTTGCCGCTGATTGTTTTCGCAAATTGGCGAGGCTTCTCCGGTGG
        CATGAAGGACATGTACGAGCAAATCGTCAAGTTCGGAGCATACATTGTCGACGGCCTGCGGGAGTACAAGAAGCCTGTGC
        TCATCTACCTGCCGCCCAACGCCGAGCTGCGAGGTGGAGCCTGGGCCGTGTTGGATTCCCTCATTAACCCGCGCTACATG
        GAAACGTATGCCGATCCGGAGGCCAGAGGAGGAGTTCTCGAGCCGGAGGGCATTGTGGAAATAAAGTACAAAGAGAAGGA
        CCTGGTCAAGACGATTCACCGCTTGGATCCGACCACCATTGCGCTGAAAAAGGAGCTCGATGAGGCAAATGCGTCTGGCG
        ACAAGGTCAGGGCTGCTCAGGTGGACGAAAAGATCAAGGCCCGCATCGCTGTGCTAATGCACGTCTACCACACGGTAGCA
        GTTCACTTTGCCGACCTGCACGACACGCCGGAGCGAATGCTAGAGAAGGAGTGTATCAGTGAGATTGTGCCTTGGCGCGA
        TTCCCGCCGCTGGCTGTACTGGCGTCTGCGACGTCTCCTGTTGGAGGACGCATATATTAAGAAGATCCTGCGCGCTCAGG
        ACAACCTCTCCGTGGGTCAGGCCAAGCAGATGCTGCGTCGATGGCTGGTAGAGGAGAAGGGTGCCACAGAGGCTTATCTG
        TGGGACAAAAACGAGGAGATGGTGTCTTGGTATGAGGAGCAGATCAATGCCGAATCTATTGTTTCCCGCAACGTGAACTC
        CGTGAGACGGGATGCCATTATTTCTACCATTTCGAAAATGCTCGAGGACTGTCCCGACGTAGCGCTGGACGCTGTTGTGG
        GTCTTTGCCAAGGTCTGACGCCAGTGAATCGAGGCGTGGTCGTACGCACATTAGCCCAGATGCAGCTGAATGAGGAGACC
        TCTAACAGCAACCAGGGATGATTCTACGCTATGTTCTAAGTTCTTTTTAGGCCCTCTATTTCATCCTTCCCGTTCCCGCC
        CTTCACCACATTTCTCAGTCCCGCTTTGCGCTTGTAAGATATCGCAAGGCGTGCATGATGTGCATTTTGTTTAGTTAAAT
        TTGTTTAAAAGTAATTAGCGTAAATCTAGTTATGTATTGGAGTTGTAGGCATGGGTTAATTTGTTGCCTAAGTGGCCCGA
        TAAACTAGTTGTATCGTGTACATATTTGATTATGTATATCCCCTGAATACAAATCATTCCATTAGTTGTATAAGAACTAA
        AGTCCTTTGTACACAGAGCCTTTTGAATAATACGAGTTACTGAAAAAATAAATGTATGGTACACTACATTAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0088871
        8010
        FBtr0113053
        7950
        FBtr0339123
        7741
        FBtr0339124
        7860
        FBtr0339125
        7814
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0087948
        2323
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0087947
        2482
        FBpp0111966
        2323
        FBpp0308268
        2348
        FBpp0308269
        2323
        FBpp0308270
        2323
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        ACC-RB
        CG11198-RB
        CG8723-RA
        Secondary FlyBase IDs
          References (2)