Open Close
General Information
Symbol
Dmel\pk-RC
Species
D. melanogaster
Annotation Symbol
CG11084-RC
FlyBase ID
FBtr0089044
Feature type
Associated gene
Evidence Rank
Length (nt)
5224
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 14 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AGTCTGAAAGCGTCGTCAGTTGCGAGCGGTTTACATCTGGCAACAGGTGCGGGTTAGTCGTCGCGTAATCCGTCTGAACG
      ATCGATCGATCGCGCGCTCTTCGGCTATGTCGATTTCGGTCCACGTTATCTTGCGCCAGATCTGTCGTTTACCGTTTTTC
      AGCCAGATCGGAGCAAAGTGCACAAAAAGCTGCTAACTGAATTCGCAACAATTGCAAAAAATTGACAAAAGTGAAGTGCA
      ATCCATAATCCAGAGTGGTCCCTATCAGGGCCAGCTAAATAAGTCTGGCATAGTGTTCCTTCCTGGGGCCAAGTGAATTA
      ATGCAACAATTGGCCTAAGCGCTCATTTACGCTAAATGCTCGGGATAAGCCACACGGGCAATTCCTAATCAATGCAGTGA
      CCATACCATACTATACAATCAATAAATATTGATTTTTTATAAAGTGGTATAAATTAACTAGTTCCTAATCAATGCAGTGA
      CCATACCATGTATTTTAAAGAATATATGTAATGTACGAAAGAGTACAAAATGCTTGAAACGCCACAAACAAACGCCGAAT
      TTAAATAAAAAAAAAAGTGTACAAAAAACTACAATCATGTAATTAAAATTCCACTCGAAGCTAAATTTACGAGGAAAAGC
      TGAAAGAAACATGTAAAACAAAAGCAACCAAAAAGCAGGTACAAGAACAAAATGACACTGCCGACAAGAAAAGACAACGA
      GAACTGAAAAATAATTACGGGCCCAGAACAATAATAATAAGCAACATGAGCAGCCTGTCAACCGGTGGAGGAGCAGGAGG
      CTCCAGCGGAGGACCGGGGGGAGCAGATGCTGCCGCTGCTCCTGCTGCTGGCCAGGCAACAGTAACGGCCACTGGCAACA
      TGGAGCCTGCGATGGTGCCACGTACCGCCAATTTGCTGGCATGCAAACAATGGTGGCGCGTCTGCTTCTTGTACGGGGAC
      CAGCAGAAATATTATCGACAGCTCTATAGCAAGGCGGCGGCCCAGCGGCTGGCGGACGCTAATCAGGAACCCGACAATGC
      CCGCGATCGGGAGTACGACACCGTGGACTGCGATCTTATCGCCGGGCAATTAGATGCCGTCGAGGATGCGGACGATGGCA
      TCGATCTAGGCGATCACTCGTCGACCCCGAAGGGAGGTGCGACGACGGCGGGCCGTCCGCTCTTCCCGCATTCCTCCTCA
      CCGCGGCGCAGCAAGAAGCTCCTGAGATCCCTGCGAGCCCATGTGCGCGGGGAGAAGCTGCCGAAGAACGACACTACGAC
      GGCTAACGAGTCCAGCGAGGTGACCCAGCGGAATGCCAGGGTGACCGTTCTCGACGACCCCTTTCTATTCGGCATCGACG
      CCGATCACTTGGGCGATCTCGTGGTGCGGGGCAAGCGGTACAGTACGCTAGACGCCACCGAGAACATGGCCAGGTTCTAT
      GCGGAGCAGGAGGCCACGGCCCAGGTCCTGGAGATCATCGAGCAGGAAGAAGAATCTCCCGAGCAGGAAGCTCCCAAGCC
      CGCCCTACCGCCCAAACAGAAGCAGCAGCGTCCTGTGCCGCCACTGCCACCACCACCAGCGAACCGGGTCACCCAGGACC
      AAGGAACGCAACCTGCAGCACCACAAGTGCCCCTGCAACCCCTGACCGCCGGCGATCTTCAGTTTCTAAACTTGAGCCTG
      CGGCAGAGGAGTTTACCGCGCAGCATGAAGCCGTTTAAGGATGCCCACGATATCAGTTTCACTTTCAACGAACTGGACAC
      GAGCGCCGAACCGGAAGTGGCGACAGGAGCCGCCCAGCAGGAGTCAAATGAGCCCATCAGCCGAACTCCGCTAACGCAGA
      TCTCCTATCTGCAGAAGATCCCCACGCTTCCGCGCCACTTCTCGCCCAGTGGGCAGGGCCTGGCCACGCCCCCAGCCCTC
      GGCAGCGGCGGCATGGGTCTGCCCAGCAGCTCCTCCGCCAGTGCCCTCTACGCGGCCCAGGCAGCAGCCGGAATCCTGCC
      CACCTCCCCGCTGCCACTGCAGCGCCACCAGCAGTACTTGCCGCCACATCACCAACAGCACCCGGGAGCTGGAATGGGAC
      CAGGACCAGGATCGGGGGCAGCAGCAGGACCGCCCCTTGGCCCCCAGTACTCGCCAGGCTGCTCCGCCAATCCCAAGTAC
      TCGAATGCCCAGCTCCCGCCACCGCCGCACCACCACCACCAGCTATCGCCGGCTTTGTCGACGCCCTCGCCACCCTCGCT
      GCTCCACCATCCCGCCGGAGGCACTTCCTCTGCCTCGGCCCACGCCCCCTTCCTGGGCGGACCGCACATGGACATGCAGC
      GGCAGTCGCACTCGGACGACGACAGTGGCTGTGCTCTGGAGGAGTACACCTGGGTGCCACCCGGACTGCGGCCTGATCAG
      GTTCGCTTGTACTTCTCGCAGATACCCGACGACAAAGTGCCATACGTCAACAGTCCGGGGGAGCAGTATCGTGTGCGACA
      ATTGCTCCATCAACTTCCGCCGCATGATAACGAGGTTCGTTACTGTCACTCACTGACGGATGAGGAGCGCAAGGAGCTGC
      GGTTATTCTCCACGCAGCGCAAACGCGATGCCCTGGGCCGCGGCAACGTGCGGCAGCTGATGAGCGCCCGACCCTGCGAC
      GGCTGCGACGACCTAATCTCCACGGGCGACATCGCCGTGTTCGCCACGCGACTGGGCCCCAATGCCAGCTGGCATCCGGC
      GTGCTTCGCCTGCTCCGTCTGCCGCGAGCTCCTCGTGGACCTTATCTACTTCCACCGGGATGGGCGCATGTACTGCGGAC
      GCCACCACGCCGAGACCCTAAAGCCCCGCTGCTCGGCCTGCGATGAGATTATCCTGGCAGACGAGTGCACGGAGGCGGAG
      GGCAGGGCGTGGCACATGAACCACTTTGCCTGCCACGAGTGCGACAAGCAGCTGGGCGGCCAGCGGTATATCATGCGGGA
      GGGCAAACCCTACTGTCTGCACTGCTTCGACGCGATGTTTGCCGAGTACTGCGACTACTGCGGGGAGGCCATCGGGGTGG
      ACCAGGGCCAGATGAGCCACGACGGGCAACACTGGCACGCCACCGACGAGTGCTTCTCCTGCAACACTTGCCGCTGCTCG
      CTTCTGGGACGCGCCTTCCTGCCGCGACGAGGGGCCATCTACTGCTCCATCGCCTGCAGCAAAGGAGAGCCGCCCACGCC
      GTCGGACAGCTCCGGCACCGGCATGTACACCACGCCAACTCCGCCCACACAGCGGGTGCGGCCCCATCCGCAAGCGCCTC
      TGCCGGCGCGCATTCCCAGCAGCCACGCCTCCAGCTCGCCGCCTATGTCGCCGCAACAGCAGCAGCAGCACCAGGCTACC
      TTCAACCAAGCGATGTACCAGATGCAAAGCCAGCAGATGGAGGCGGCGGGCGGACTGGTGGACCAGAGCAAGAGCTACGC
      CGCGTCCGACTCGGATGCGGGTGTGGTAAAGGACCTAGAACACGGCGGACATATGGGCGGAGGAGATCTGACGGACTTTT
      CGGGTGGACGGGCCTCCAGCACCTCGCAGAACCTATCGCCTCTGAACTCACCCGGCGACTTCCAGCCCCATTTTCTGCCC
      AAGCCCATGGAACTGCAGCGCGACGGAGTGTACAACTTCAACGAGATGTCCTCTAATCTCGATGCAGCCTGGTCAGCGAA
      GCCCACAAACAGTTACCATCTGCAGAGACAGCTCCTGGAGAACCCCCACACCGCCAGCATGCCGGAACTGGCGGGTAAAC
      TGGTGGCGCCTCCTGCACACATGCAGCACCTGTCCCAGCTGCACGCCGTGTCCTCGCACCAGTTCCAGCAGCACGAGTAC
      GCGGACATCCTGCATCCGCCGCCTCCTCCGCCTGGTGAGATTCCCGAGCTGCCCACTCCCAACTTGAGCGTGGCCTCCAC
      CGCCTTGCCGCCAGAGCTGATGGGCTCACCCACCCACTCGGCGGGCGACAGGTCGCTGAACACGCCCATGTCCACACAGT
      CGGCCTCCCACGCGCCCCCACATCCGGTCTCCATACTAAGCGGCGCCTCCTCCTCCTCGCCGATGAGCGGGGAGCCGGCC
      AAGAAGAAGGGCGTGCGCTTCGAGGGAATTCCGGACACACTGCCCCGATCACGCAGCTACTCCGGTAACGGAGCGGGAAC
      GAGTGGCGGCGGCGAGAGGGAGCGGGATCGGGACAAGGACAAGGAGGGAGGAGGTCGCCATGGTCACGGTCACTCCTCGC
      GAAGGCGAAGACGTCGCAAGTCCTCCTCCAGCTCGTCGCACCATCGCAGCGGCAGCGGTCATCGCTCCCACTCGACCACT
      CGAGCGGACACCTATGCACCTGCGCAACCCCTATCCTCGTCCTACCAGGGTCCACCTTCGGTTCTGCAGGCTGCCAACCT
      GGTCCACGAGTCACCCAGCCGACAGCAGAGGGAACGGGAGCGCGAGCGGGAACGCGAGGAGTCCGAGGAGTCTGACGTGT
      GCTCCACCTGCTCCTCGAGCTCCTCCAGCTCGGAGGACTACATGATGATGTACCAGCTGCCGCAGAGGCGCCACTACGGC
      GGCGTGCGCGTGAGCTATGTGCCCAACGATGCACTGGCCTACGATCGGAAGAGGAAGCCCAGTGAACTGGGCGGCGACAA
      GGACAAGAACTGCATCATCTCGTGATGCCGTCCGCCGGAGGGGTTCCAATCAGAGCCGAGGTTCGAGCACAGGTCCAGAT
      GCTGATGCAGATCCAGATCCAGATCTTATTAATGTGGAGCCACGGGCAACTCCATCTCGTGGCTAACGAAGTGGCCCAGA
      ACGCTCGCGGGGATCATCAATTCCTGGGAAGGGAGGCAACTGCCTCTCCACAAAGCAAAATAAAGTTCAACTTGACATTA
      AGGCGCCTAGTTAAGGTACACTCACAAACATACATATGCAACTCCGGAGGAGGAGACCCTACAATAAGAGCCAACACTGT
      TCCAAATACACATCCCTAGTTAAGCTAATTGAACTATATACATATATTTTTATTATTACCGATAGCATAGCGAAGATACA
      TTGCAGATAACCCTATTTATACACTTTATTTATATTTATTGCATTCTAGGCTTACCAATTACACTAAGTATATGCCTAGA
      CAAATAAGTAGAAATGCTGACGATTGGGCTAATGAAACTCTACAATAACTTAGTTTAAGCGAAATCACTGTATGACATTC
      ACGAGAATAAAGTTCAAAAGGAGT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0089042
      4241
      FBtr0089043
      4109
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0088115
      1299
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0088113
      963
      FBpp0088114
      1029
      Comments
      Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (3)
      Reported As
      Symbol Synonym
      CG11084-RC
      Secondary FlyBase IDs
      • FBtr0006092
      References (3)