Open Close
General Information
Symbol
Dmel\Eph-RD
Species
D. melanogaster
Annotation Symbol
CG1511-RD
FlyBase ID
FBtr0089085
Feature type
Associated gene
Evidence Rank
Length (nt)
3691
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 124 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Sequence
      TTAATGACGTTATAAAAGTTATCGATACCAGTTGTTTTAACAGAATTGCTGAGTATAAGTGAATTTAAAAAATAAAAAAT
      AAAGAAAAAAGACTGAAAATGATACTCTGGTCTTTACCAAGTATCAATAGAAAATCTACAAGGGATTTTGTGGTCGTAAA
      AGAACCACTTTAAAATTAAAACGAGACTTCCATAGTAGTAGTCGGCTGTAAAGTCTTGGATTTTAAACTGGACCCACAAA
      CACAAATAATGCTATTGACATTGGTAAATCCGCATCAGAGTGCGTACAACCCAAATCAAAAATAAAACTGTTCGAAAACG
      ATCCCAACAAAATGAAAATGGTTGGGTGCCACCCAAATGACAAAAAGGTGAAATATGATGGTATTAAAAGTAAAACTTCT
      TCCGTAACCATTCTAACTTCCGTACTAAATGATGCTATAAGCGCCCTCAAGTCTGCGTTTTACAAAAATCAAGCTCCAAT
      TAGCGAGCAAAACAGATCTCAAATTGTTTCGAGAATGTCATTATTAAGGACAATACTGCTTATTATAATTTCAATTCACT
      TTAAATTGGCACATGCAGATCAGGTTGTTCTATTGGATACAACTCGAGAAGCTACATTAGAGTGGACCAGGTATCCATAT
      GGACCTCAAGCCCAAACACCAGGGTGGGTGGAGGAGTCATTTACCGACTTCGTTAAGGGCATTAACTGGAGGAGCTATGT
      GGTTTGCGATGTGGCATATCACAACGTCAATAACTGGTTGTGGTCGCCGTTTATCGATCGTGGATCAGCAAACCGACTTT
      ACATTGAAATTCAGTTCACAATACGCGATTGTTCTTTATTCCCAGGAAACGCCTTGTCATGCAAGGAAACATTTAGCTTA
      CTTTTTTACGAGTTTGATGCGGCTACTAGAGAACCTCCACCATGGCAAACAGACAGCTACAGGCTGATTGCTCGCATCGC
      GGCTGGCGAGGGGCGCTTCAATCAGAACTCCGATGTAGATATTAACACAGAGGTGAAGAGTATAGCCGTCAACAAAAAAG
      GCGTATATTTTGCTTTCAGAGATCAGGGCGCTTGTATTAGCGTTCTGGCAGTAAAAGTATATTATATTACGTGTCCTGCT
      GTTACCGAAAACTTTGCACACTTTAACGAAACACCTACGGGAAGAGAAATTACTATAATTGAGAAACAAAATGGAACATG
      TGTCGATAACGCAGAACCGTATGAGACGCCAACTTACTTATGTAAAGGTGATGGAAAATGGACAATTCTTACTGGTGGGT
      GTCGTTGCAAGGCTGGCTATGAGCCGAATTACACAAATAAGACTTGTACAGAATGTCCACTTGGGACATTTAAATCCCCA
      GAGGTTACAAAATGTACTCCGTGTCCTCCCAATTCAAATGCTTCAAAAACTGGTTCACCTTTCTGTAAGTGTGCGTCTGG
      ATTCTATAGACATCCAAATGATGGTCGACATATGCCGTGTTATAGTCCACCAGCTGCGCCTACTAATCTCACGTTGTTGT
      TTGTTGATCAAACAAGTGCAATAATATCTTGGAGCGCACCGGCCAAAAATGAATCGTTTTCATCTGAAACTAATTCTAAA
      ATATATCACAGTGATATTGTGTACAAGATCAAGTGTAATATATGCAGCCCAAATGTGGTTTACAATCCCTCAACTGACAC
      ATTTAACGAAACAAAAATAACACTTACAAATCTGGAACCGGTAACGACATACACTGTGCAGATACACGCAATAAATAGCG
      TGTCTCATATTAACGAATTTAAAAGGCACTCCAACGAGTCTTCCCTGGTGGCAGTCAGTGACATAGTATTTTCAAATACG
      TCTTTATTAAATATACCTTTGGATTTAAACGAAGTAAAGACTGGTCAAGCTGAAATCGTTTTTACAACTGAGTCAGTTTT
      GCTCTCGACAGTTTTTAATTTGCGTATATTGGCTATAACTAATAAAGATGCCGATCTAGAATGGGATAAACCTGTTCAAA
      GTGATTTTCCACTTGAATTTTATGAAGTGCGCTGGTTTCCAAAGGTCGAATTAGATGCTATAAATAAATCAGCTTTGAAC
      ACAAAAGAAACGAAGGCACATATAGTAGGACTTCTAGAAAATACGGAGTATGGATTTCAAGTTCGTTGTAAAACGAATAA
      TGGATTTGGCTCTTATAGTAACATGATTTACGCCCAAACTCTTCAATCCGTTGGTTCAGTATATGACGATTCTGTGCAAA
      TACGATTTATTGCTGGAGCCATCGTGACGGGAGTATTATTTCTAGTCATTTTTATAATAGCTACAGTATATTTCATGAGA
      TCGAAGCATCAGGATGATCTTGATAAAAAATCGACAAATCATTTGCCATTACCACTTGACTACGCCAGCAACGAAGTTAA
      TTCTATGGATACTACTCCAATTGTTAAAAAACTTCATTTAAACGTGACGACGCCTTTATTTGGAAATAGCAGAAGCTACG
      TAGATCCGCATACCTATGAAGATCCTAATCAAGCTATAAGGGAATTCGCTCGAGAAATCGATGCAAACTACATTACAATA
      GAAGCTATTATCGGAGGTGGAGAATTTGGCGATGTATGTCGTGGTCGATTAAAAATACCCCCAAACTTTGTACAGGACAT
      TGATGTGGCAATAAAGACTTTAAAACCAGGGTCTTCGGAAAAAGCGCGCTGTGATTTCTTGACAGAGGCTTCTATTATGG
      GACAGTTTGATCATCCAAACGTTATTTATCTACAGGGAGTAGTTACTCGGTCTAATCCAGTTATGATTATTACTGAGTAC
      ATGGAAAATGGCAGCTTAGACACATTTCTTCGGGTGAATGATGGAAAGTTTCAAACATTACAGCTTATAGTTATGCTTCG
      GGGTATAGCCAGCGGGATGTCATATTTAAGTGATATGAATTATGTACACAGAGACTTGGCGGCACGTAATGTTCTTGTAA
      ATGCCCAATTAATATGCAAAATCGCGGACTTCGGATTGTCACGTGAAATTGAAAATGCAAGTGATGCATACACAACTCGG
      GGCGGTAAAATTCCTGTACGTTGGACTGCGCCGGAAGCCATTGCTTTTAGAAAATTTACTTCAGCATCGGATGTTTGGTC
      GTATGGAGTAGTTCTATGGGAGGTCATGTCCTATGGGGAACGTCCATATTGGAACTGGTCAAATCAGGACGTGATAAAGA
      GTATAGAAAAGGGCTACCGTTTACCAGCTCCGATGGATTGTCCAGAAGCCCTTTATCAGCTAATGTTGGATTGCTGGCAA
      AAGCAACGTACTCATCGCCCCACATTTGCAAGTATCGTTTCAACTCTTGACAATTTGGCACGACAACCACAGTCATTATT
      GACAACACGACCCTCGCCAGAATCAGACGGTAATCATATTTTGGATGGACAGCGCGGTCAAAATATTTTCATAAGCACTG
      ACCTTTGGTTAGAGCACATTAAAATGTCTAGATACTGTCATCATTTTAAAGAGGCTAATTTAATAAATGCTCAACAGGTA
      AACTCTTCTAATTATCATTTTTGTATTAATCAATTTTTTATTGTCAAATATTAATAGTAATTTTCGTGTACAGATATCCA
      GGTTAACAGCTCAACAACTTTCGGACATGGGAATTACTTTAGTTGGACATCAAAAAAAGATCTTACATCAAGCCCGGCAA
      CTCGACACTAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0089082
      4142
      FBtr0089083
      4068
      FBtr0089084
      4190
      FBtr0089086
      5630
      FBtr0301285
      3854
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0088154
      1080
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0088151
      1080
      FBpp0088152
      1047
      FBpp0088153
      1096
      FBpp0088155
      1080
      FBpp0290500
      1005
      Comments
      GC splice donor postulated.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG1511-RD
      Secondary FlyBase IDs
        References (2)