Open Close
General Information
Symbol
Dmel\Ekar-RA
Species
D. melanogaster
Annotation Symbol
CG9935-RA
FlyBase ID
FBtr0089102
Feature type
Associated gene
Evidence Rank
Length (nt)
2971
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTCGTTTCTTTTATGCCGAAGCGGCTGTAGTCGTAATGTTAATAGCAAGCGGCTTCTTACTGTTTCAGTTTCTTTCATA
        CGGTTTGGGAGTTCCACCCTTGGTCAGAATTGGAGCTATATTTTCAAACCAGCCTGGAATGTATAACTCGGAGTTAGCGT
        TTAGATACGCTATTCATAGACTTAATATGGACAAAAGCCTTTTGCCTGAGACTACCGTTGATTACTATGTTGAATACGTA
        AACCGATTTGACTCTTTCGAGACAGTTCAAAAAGTGTGCAAACTTATACGAGTTGGTGTTCAAGCTGTTTTTAGTCCAAC
        TGACTCTGTTTTGGCGACCCATATAAATTCAATTTGCGACGCACTGGACATCCCAAACATAGGCCGGTCTGCCCATGACT
        TTTCTATTAACGTCTATCCATCGAAGCAACTTGTAAATTATGCCTTTAACGATGTAATACAGTATTTAAATTGGACACGC
        TTTGGGATATTGCATGAAAAAGAAAATGGAATCATAAACTTGCATCAGCTATCCCGGTCATTTCACGGAGAAGTTCATAT
        GCGACAAGTTTCTCGGGATTCATATGTATCCGCATTGAACGAATTTAAAGGAAAGGAAATACATAATATTATTATTGATA
        CAAACTCGAACGGTATTTCCATATTGTTGAAAAATATATTGCAGCAACAAATGAATGAATACAAGTACCATTACTTGTTT
        ACAAGCTTCGATTTGGAAACTTATGATCTGGAAGACTTTAAATATAATTTCGTGAACATTACATCGTTTCGATTGGTCGA
        CACTGCGGATGTTGGGGTAAAGCAAATCTTGAAGGATATCGGATTGTATAGTCACCATATATTTAAAAAACCTTATTTGA
        ATCTACATATTAAAAAATCAACCATTCTTGAGTCAGAGCCAGCCCTAATGTTCGATTCGGTGTACGTTTTCGCGATTGGA
        TTGCAGACACTGGAACAATCACACTCTTTAACCCTTTTAAATATAAGCTGCGAGGAGGAAAACTCGTGGGACGGGGGCCT
        TAGTCTTATTAACTACTTAAATGCGGTTGAATGGAAAGGTCTGACAGGTCCGATTCAGTTTAAAGATGGCCAGCGGGTCC
        AGTTCAAGTTGGACTTAATTAAATTAAAGCAACATTCCATTGTAAAAGTCGGGGAATGGACTCCTCATGGGCATCTGAAT
        ATAACTGAACCATCAATGTTTTTCGATGCTGGGTCCATGAATGTGACACTTGTAGTGATAACAATTCTGGAAACACCATA
        TGTAATGATGCATTATGGGAAGAATTTTACGGGAAACGAACGATTTTATGGTTTTTGCGTAGATATATTGGAAACCATTT
        CTCGGGAAGTTGGGTTTGATTACATACTGGATCTGGTACCGGATAGAAAGTATGGGGCCAAGGACCCCGAAACTGGGGAA
        TGGAACGGAATGGTCGCTCAGCTGATGAAATATAAGGCGGACCTGGCAGTTGGATCTATGACTATAACGTATGCAAGAGA
        AAGCGTCATTGATTTTACCAAACCATTTATGAACTTGGGGATAAGTATTTTATTTAAGGTCCCAACATCAGAGCCAACGA
        GACTTTTTTCATTTATGAATCCATTAGCGATAGAGATTTGGATATATGTGCTAATTGCATATTTTCTTGTGTCTCTCTGC
        ATATATATTGTTGGAAAACTTTCGCCTATCGAGTGGAAGTGCATTAACGCCTGCGATCTAGAAAATATTTCTATTGGCAA
        CCAGTTCTCCCTAACTGACAGTTTTTGGTTTACCATAGGGACTTTTATGCAACAGTCACCTGATATTTATCCACGAGCAA
        TGTCGACTCGAATAATAAGCAGTACTTGGGGTTTTTTTTCACTTATTATTGTCGCATCCTACACCGCAAATCTAGCAGCT
        TTTTTGACAACGGAGCGCATGATTAATCCTATCGAGAACGCAGAGGATTTGGCTTCTCAAACTGAGATTTCTTATGGCAC
        TCTAGATAGCGGATCTACAATGACATTTTTTCGGGTATGCAACTAGTAAAGTGGCAAATCTTCTTTGATAAGTAAATACA
        TTCATTAAGTAGGACTCAGTGATAGAAACTTACAAAAAAATTTGGAGAAGCATGGATAACAAAAAACCATCTGCATTTAC
        CACTACTTATGAGGATGGTATTAAGCGAGTAAATCAGGGTAATTATGCGTTTTTGATGGAATCCACAATGCTTGATTACA
        TCGTTCAGAGGGATTGCAATTTGACGCAAATCGGAGGACTTTTAGATACAAAAGGTTATGGTATCGCTACACCAAAAGGT
        TCGCCTTGGCGAGATAAAATTTCATTGGCTATACTTGAGCTTCAAGAAAGGGGTGACATTCAAATGTTGTATGATAAGTG
        GTGGAAAAACACTGATGAAACATGTACTCGCAAAAACACAAGCAAGCAATCTAAAGCAAATTCACTTGGTCTGGAGAGCA
        TAGGCGGCGTATTTGTAGTGCTAATAGCTGGAATTATTGTGGCTGCAGTTGTTGCGTTCTTCGAATTTTGGTATAACTTT
        CGATACAACTATGAAGCTACACCATCTCAATCAGTCGTTAACAATAAATACAATCAAGATGGGATCCTCGAAAGCGAAAG
        AAACTATACCCCACCTGACCGTTCATTTTGGATCGAAATTGCTGAGGAACTCCGCTACGCATCTTGGTGTATGAACAAGC
        AAAAGAGGCCTGCACTAACTCGCACATGTAGCAAATGTACCATCCCGAAAGGCCAACGAATTAATAAACTATGAAGGCGT
        AATGCTTCTTAGTATTGATGCTTTTTTTTCGATTCGATCTATGTTTTATAAGTTCTAGTTTTTAAAAAGATTCAAGGATT
        TAAGAAATTAATTCTAATAAATTACATACATATACTTGGAAATTATAAATTTATAAAGAAAGCTAAAAATATATAAACAC
        AATTACAAAAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0110906
        2913
        FBtr0344874
        2910
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0088171
        669
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0110206
        899
        FBpp0311188
        898
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Based on cDNA(s) with retained intron; results in premature stop codon and/or downstream start; may or may not produce functional polypeptide.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG9935-RA
        Ekar-RA
        Secondary FlyBase IDs
          References (2)