Open Close
General Information
Symbol
Dmel\CG1674-RD
Species
D. melanogaster
Annotation Symbol
CG1674-RD
FlyBase ID
FBtr0089119
Feature type
Associated gene
Evidence Rank
Length (nt)
1457
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GACAGTGTGGAAGCTATCTTTGATGTGCAATCATATTCTTAAAGGCAGGCGCATGAATTCATGTTCATTCTATTGGCCTA
      TACGGATTTTAGTTGTATTATTATCTTTCAATAATTCGATACTACAGTATTGTTTGCAGTAAATATTTTTTTAAACAAAT
      AACATTGGGAAATAGGCAAGTGAAAAGATATATTTGATATATATTTGTACAGCTTTTAGATATGGATTCTACTTTAAATA
      TTGAGAATGTCAATGACCCAACATCCATTGCATCTGATTTATCGGCCGAAAACACTAAAGCAGACCTTGTTTCGCTAAAT
      GAACCGAATGTCAATGACCAAACATCCAGTGCATCTGATTTGACGGCCGAAAACACTAAAGCAGACCATGATTCGCTAAA
      TAAACCTAAGGATTTTAATAACCAAATTCTGAACATTATATCGGATATAGATATAAATATAAAAGCACAGGAAAAAATAA
      CACAGCTTAAAGAACAAGAACTAAAACTCATTCAGAAACAGAATGATCTGGCAAATGAAATCCATAAGCAGCAGATCCTA
      GCTAAGCAGCTTAGTGCACAAAATCAGCTTAAACAAAATGAATGTCAAAGTGGAGAGCTCGACTTACACAGTCAATATCA
      AAATGAGCGCGGCGGACCCACCTCGACACTGTATCAGGAAAAAAATATAGCCAGTAAAGAATCCGCTAATGTGTCGAAGA
      CGGTTGATTTGCGAAAAATATTTACACCTGCGACCGATGCTGCTGAAATATTACCGAAAAACCGAAAGCTATATGCCTCG
      TCTGCATTTTATTCTCCAACACTACACCCTACAGTGGAAGACCAAGTCGAGCTAGCTCGAAGAATTTCACATTCATTAAG
      CGATATAAGTAATCAAACCTCTAAGGGTCAGTCTATGTATGTCAATCGCAAAAAACGCTCAGACAAATGGGTTCATGAAG
      GTGGATCTCAAGGTAATGTTTTTTTTCAATATTTTTTGTTGTCAGTCAGTTATTAATCAATTCTAGTTCCTACAATTGTA
      TTATTATAACACTGATTGCAACTTTTAGTACAGTGGTCAAGAAAAATCTCATTAGTCTAACTCTCCACTATAACAGGGAT
      ACCCCGTTTCCCATTGTATGTGATTTTTGTTAAAAATTTAAGTTTCTTGAATAGATTTTTATAATAAAACGATTATTTTT
      AACTTGGTTTAACATAAACAATTCAACTGTTTATACGTTAAATAAAATTAATGTATTAGTATGTTCCCCAGTAATAAACA
      CGTACAGTGCAGTCTTGATAGTTTTCCGGTGCGACACTAATTTTCTGTTGTAATGTAATGAACTAAAAAATATAACATGT
      AGGAAATATTTTAAAAATATTGAAAAAAATACAAGTGACGATTGCACCTTCAACACATGTACAAAAGATCTAATACTAAT
      AAATTTTTATGACGAAG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0089116
      2557
      FBtr0300796
      2989
      FBtr0300797
      2899
      FBtr0300798
      3016
      FBtr0300799
      2131
      FBtr0300800
      2419
      FBtr0308086
      2917
      FBtr0308087
      3052
      FBtr0333671
      2893
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0088188
      264
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0088185
      743
      FBpp0290020
      884
      FBpp0290021
      884
      FBpp0290022
      884
      FBpp0290023
      589
      FBpp0290024
      694
      FBpp0300429
      860
      FBpp0300430
      905
      FBpp0305827
      843
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG1674-RD
      Secondary FlyBase IDs
        References (2)