Open Close
General Information
Symbol
Dmel\CG31998-RA
Species
D. melanogaster
Annotation Symbol
CG31998-RA
FlyBase ID
FBtr0089145
Feature type
Associated gene
Evidence Rank
Length (nt)
4863
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CCATTTTGTAGTTGTGTGTTTCATTTAGTGAAAAGTCGAGACGTCACAATAAACTGGATTGTTTTTGTCAATGATATTAC
        CAAAATGTGTTTATAGGGTGAATTTTTGTGTTAATACAAATTGCAAATATAAACAGATATTAAATCCAATTCTATAACAT
        AAGTATATAAACATATATTGCTTATGTGTACACATCTGAATACATGTTTTCACAAACTGCAACGGTTTTATTGGGTGTGA
        CAAACGGCTTCCACGATCCAGGAAAAGTTACCGATTCACATTATAAAATACGATATCATGCCTGAAACGTACCATTGCTT
        ACGAATCAATGTGAAAAAAAGGAGTTTTTTTACAACAGGCATCAAAAATGATTATAGCAAGGAAATTAGTAAAAATTTAA
        ACGAAAATCGTAATGAAATCACAAAGCCCAATACATGTGCTTTATCAGTATTAAAAAACGATGCAAGCGCACCAGCTGCT
        ATACTAATTTGTGCTCATAAAACGTTCACTGAATGTAATTGCAAAATCAGCAGGTTAAAGCCTAGATATTTGGGCTCCAT
        TTTTATCTCTATCTTGTCCCGTAAAATGAATTTACGTCAACGTTATGTCAATTTTTTATTTATACTATTAATTGCAATTC
        ACCATATTTCCTTGTCGAAGTCATTATTATTGGAGGAAGGAAATTCAACGGGCAACAACAGAACCATTTCACAAGAAAAG
        TTTAATGGAAATCATAACTTCAGCAACAGCACTGGAATCAACATGATTTCCGGGACATCATCTATAGTGCAAAAGGATTA
        TTTGGAAAAATTAAATAATATTGAGCGTAGTGTTGCAGCTGTTCTCATTAAAGTAGCATATGGTACAACCTCAACAACCA
        AACGAAGCATACCAGACACAAGTTATTCACTAGGTCTAACTACTGTTGCCACACCATTTTTAACCACACAGAGATATCAC
        TCGTCACATCAACAACATGGTGTTGGTGGACGTCCGAAAAATTATGAACTAGACTTGGAGAGGGACCATGCATTGCCCAC
        ATCTGCGCCCAACGCAGATATTTTAAAAAGTAATAACAATCCGACATACCCGAATCCAAATCGCCACCATTCACATGATA
        GGGATCGTCACAGGAACGTTGTACTTCATAGTTCGACGCCAATACCATCGATTCCCAACCTGTTAAAGAAAATAAATGGA
        GCCCAGCCGCCAACAATACCAATGTATCCTGGTGACATTCCATCATATTCTCCACCGTCTCGGGCCTTTTTCACACCTCC
        ACTTCCACCAGAATACCAAAACCCATTTGCAGACAAGCCCACTTTACGAGGTACCAATAACGAGGGTCTAATTGCAGTGA
        ATAGGCGTCCTATCCCACCGCCTAGTTTGATGCCCAGCCAAGACCGAATACCAATTCGACCACCAGACCTGGGAAGCAAT
        AATAACGACGCCGTTGTCAATTCAATGACGGACTTAAATTACGCTCCGTCTGGCATGGATGCAAAGCATCGTCTCGAAGA
        AAATTTCGCCCATGGAACAGTGTCAGATATATCCGGAGTAGAGCGAATAAAAGCTTTGAATACACCAGCACGTGCCAGCG
        GAGAGGAATATTTATACGAAAAGGCAAGTAGCGCAAAAGGTCAGGGATCCTATGAAGTGGATGCCATTGGTCCAAACAAA
        AGACAGGAAGTTTTACCTAATATTAGACGTATTCTGGGATCAAAAAATGGTGACATACCAGCGGTTTTATTGAAGCACGT
        AACTCAGCGACCCATAATTACATTGCGGCAACCTCCCTCTTCCCCAATTGTACTGATCGAAAAGTCAACATCAAACGAGG
        AAATCATAGATGCTGATGCACCATCCGTGGTTAGTCCTAACATTAATCATAGCAAGTACCACCCCGGGCAGTTGGAGTAT
        TATGAAAATGCGACTGCAGGAACGACGCCATCAGCAGCTGCTGCAATAGGAGATGTATCAGCTACTTCATTTTCCTACGC
        CACCACAAATGCGGGTCAGCCAGGACATACAGGAAAGACAACGGACGCTATTAGGGAGCTTGGTACAGGCGTACCCGACC
        AGAATCCTATTGGGGCAGCTGCAGCTGCGACAGTACACACAACTTGGGCATGGGCATGGAATATTCACATCTATCTGTCG
        GTTGTACTCTTCACTATTTTATCTGTATATTCGCTTTACAAACTGCTTACCTATAACAAGCTTACACATTTGTTCGCACA
        GGCATATTTTGTGTGTATTAATCTGATTCTGATTATGATCTGCATATTGAGAATATTTTTCCTTTGCTTTGATGCATACA
        ATGTTCATGGTAGCTTTAATTTATTTACTTCAGAGCTCTTTCTTAATCTACCGTCCACATTTTTAACAGTTGCTTTCTCT
        GTTCTTATATTGTTTCTCTTCCTTAAGTCCCTAAACCACAAAAATAATAGATACTCTGCTCTGATAAGACCGCTGACCGT
        TGTTGTGGGTTGCGGGGTCCACGTTGTACTTTGCATTACATTGCATTATGTTGAATCCTATACTTTAAAAAATCATCACT
        TATACTTTCAACAACAGCAGCAACAGCAGTACTTTCGTCGGCAGCAACTTTATAACCAACAAGGCCAGCCTACGGCTACA
        ATGTCTCCATCGGCAATTTTGCCACCACCGCCCCGGGTATTAACTTTAATATGTCAGATAATTTATATTTTTATATGCCT
        GAGCCTAGGGCTGCTATATCTTTACATATACCGCATTTTAAAACGCATTCTTCGCAGCAAATCTCAAAACTACATACATG
        GCTATCAAAATTTGTCTTACGCCATTCACATTACGATTGCCACAGCTCTATTGTTTGTACTATTGGCAGCCCTTCAGATA
        TTCGGTGCTATATATATTTCATGTCGTCATACAAGTATTGTCGATGTCGACTGGCTGCAATGGGGATATCAGTTCTCTCT
        GCGTCTGATAGAGATAGCTATAATTACTTTAATGTCCTGGGTAGCTGGACTAAAGACAAGTGTCGAGCACGATTCTTTGA
        GTGCCGTTGCTGGAGATGTTCGCATGATTGGTTCTGGTATGGGTGCATATGGCCAAGATGGTGGTACACCTAACAATGCA
        ATCAGAGAAAAACATGTCGGAAACGGCACAGGCACCCATAACTCAAATGTGACAAATTTTTTCCTTCCGTGCACATCAAG
        CTCTAGTCAGGAGCATTTTGAAACTGACTACCCAGCTGTTTGCAATGCAAATACGAATCTTCATACATACACAATGCGGA
        CAGGAAAACTTATTTATGATGACAGTTACGCCCTTAATTCTATGGGACCAACAACAGCTACAACTTCAAACGCTCGTCCT
        TGTGAATATCAGCTACAGGAGCCTATGTACCAAAGGCCATATGATACGGGGTCAATTGGAAGTACTTTAAATCAACAACA
        TCAATTAAATCAAATGCGTTTCCAAGAGCATCCGACTTATATGAGTACGGACTACATGACAGATTCAGGACCAGATCATT
        ACGAAAATCCAAATTTCAGTTTGCACAGTACTGCAACTGAACAAAAGCGAAGGGATTACGATCAAAATGAAGTTTCTTTT
        AACTCAAATTCTGGGGCTTTGCAGCAGCAAGTAGAATTGTTGCAAAACAATTGTTATTCTGAACCACTAGAGCAGGAAAA
        CAAGAGATATGAATTTAACATCTTTGAGCGACCGGTGTTTAAGGAAAAATCAGTTCACAATGTTCAGTCAAACAGTGAGT
        GTATTCAAGACCGACAAAAAATAACAAATGGGCGCAAAAAAAAGTTTAACGGTGCACTTGATCGGCATGTCTTTGAAAGC
        AAGACTCATGAGCGCCGCAGTTCGAATTCAGCTAATTCGTGCTCTTCATCAAATTTGGGAGGTGGTGGGCGATTTGGAAG
        TTTTAATTCATTTGAACGCGGATATTTCAACGGCGTTTGCAAAAGTGGTACTATAAGCAGTATAGCCAAGGCTGGTGCTT
        TAGGTCGAACCCTTGAGTCACCAATTGCTTCTGCTGAAACTCAACGAATAGTCGCCAATGGATCGCAGACGTTAGGAATA
        CCAGATAAAGATAGACCACAGTATTACCAGAGAGCAAGTGGACGTAATTCGAACTTAAGGTCATTGGAGAGTGAAACTGA
        ACTGTTTAAAAGTATGCCCATAAGGGAGAACCATCTACAACAGTTACCTTATGGTCACAATTCCGAGGATGAAGAAGATG
        AAGAAGATGACACTATATCGGGAAATAATGTAGAGTGTACAAACTTGATAAATAACGATCATGGTTTTGTCATTCCTGTT
        GAAGATACGGCACCAAATTCTATATCTATGAACACAAAAACACCATCACTTGCCGGGTCAGCGGCAACTAAAAATTCCAA
        TTATCGCGCACAATTACATATGCCAAATAATGGAAAGCATAGGTCGGAGTTATGCACGACTTCATCAGCTTCAGTGGCGT
        CTGCATCTTCAAATTCATGCACAACATCCAGTGCTTCTGATAGTATGCTTGTAGCAGACCAAGGCTTTCTACGATTTCGG
        TCCATAGACGATCCAAATTGTGTTCAAAACGGAAGTAATGTAGATTCCGAAAGGACTGCAGTTTTATCCCTTCGTCTTAA
        AAGTTGCAGTGCGACGGTAAATGGCATCGATTGCTAAGATTTTTAATTCCGACTCATAGCTTTGCATGTCATAACGATAA
        CTATCTTGTTTTATAACTCACTATCAATCAAGCGCGGTTTTGATTGTCCTTTTATGTCAATAAGTAGTAAAATAGACGTT
        TTCAACTATCTTCAAACTTGTGATATATAAATATATAACAAAACTAGCGAAAAGCAAAATTAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0308249
        5980
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0088212
        1459
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0300569
        1363
        Comments

        3' UTR based on RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG11572-RA
        CG31998-RA
        Secondary FlyBase IDs
          References (2)