Open Close
General Information
Symbol
Dmel\DPCoAC-RB
Species
D. melanogaster
Annotation Symbol
CG4241-RB
FlyBase ID
FBtr0089481
Feature type
Associated gene
Evidence Rank
Length (nt)
1336
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATTACATTGGCGACACAATGAAAACTCTTGAATTTTTGTGTTTGTCGACAGTAAAATGTCGAGTATTTGACTTCAAACCG
      AACTAAATTATAGAGCGTAGTGGAGTGTCAAAGTTTCCTATGTCCCTCCGTTTATTTATCCATAGTCGCGCATTCGGTGC
      GCCAGAAAATCGACCAGGTGGTGATCAGCCTGATATCCGGAGCAGCGGCGGGGGCGCTGGCCAAGACGGTCATCGCCCCG
      CTGGACCGCACAAAGATCAACTTCCAGATCCGCAACGATGTGCCCTTCTCGTTTCGAGCCTCGCTGCGCTACCTGCAAAA
      CACCTATGCCAACGAGGGCGTTTTGGCCCTGTGGCGGGGGAACTCGGCCACGATGGCCAGAATCGTGCCCTACGCAGCCA
      TACAGTTCACGGCCCACGAGCAGTGGCGTCGCATCCTGCACGTCGACAAGGACGGCACCAACACGAAAGGTCGTCGGTTT
      TTGGCTGGCTCCCTGGCGGGAATCACCTCACAGTCGCTGACGTATCCTCTGGACCTGGCACGCGCCCGCATGGCCGTCAC
      GGATCGGTATACTGGCTATCGGACGCTGCGACAAGTCTTCACCAAGATCTGGGTGGAGGAGGGTCCGCGGACGCTGTTCC
      GCGGCTACTGGGCGACCGTTCTCGGCGTGATTCCCTATGCGGGCACCTCCTTCTTCACCTACGAGACTCTTAAGCGGGAA
      TACTATGAAGTGGTCGGCAACAATAAACCCAATACTCTAGTCTCGCTGGCCTTCGGTGCTGCGGCTGGTGCCGCCGGGCA
      AACGGCCAGCTATCCATTGGACATTGTGCGGCGAAGAATGCAGACAATGCGGGTGAACACGGCTGGCGGAGATCGGTACC
      CAACCATCCTGGAGACTCTCGTCAAGATCTATCGTGAGGAGGGCGTCAAGAACGGTTTCTACAAGGGACTTAGCATGAAC
      TGGATCAAGGGACCCATCGCCGTGGGCATCAGCTTCTCCACCTACGATCTGATCAAGGCGTGGCTCACGGAGCTGGCCAA
      CTTGAGACGGGTTGAGAAATAGCCCAGCTCCCTGCCCCTGCCACTCGTCACCCATAAACACCACACCAAAAACGCACTGC
      TTTGATCTTAAGTCTCGCGATCGATGGATGAGCTGAGGAAATAGAAGTGAAGCACCGACATGCTCTAATTGTTAGATATT
      TTTTAGCTGTTAGTTGTGAGGGAGAGAAGCGATGAAGTGAAGACACCCGAAAGCGCTTAACTTTGTTATTAACCGTAATT
      GATTTATTATCGCCGTAAGCCGAAAGTATATCAGCCAATAAACTGTCTGAATAATG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0089480
      1654
      FBtr0089482
      1898
      FBtr0344280
      1901
      FBtr0344281
      1440
      FBtr0344282
      2089
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0088486
      290
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0088485
      365
      FBpp0088980
      365
      FBpp0310685
      364
      FBpp0310686
      290
      FBpp0310687
      365
      Comments

      PolyA site from FBrf0089733; testis-specific transcript.

      Unconventional translation start postulated (CUG encoding Met); FBrf0089733.

      translation_exception: non_canonical_start_codon

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (3)
      Reported As
      Symbol Synonym
      CG4241-RB
      DPCoAC-RB
      att-ORFA-RB
      Secondary FlyBase IDs
        References (2)