Open Close
General Information
Symbol
Dmel\Caper-RB
Species
D. melanogaster
Annotation Symbol
CG11266-RB
FlyBase ID
FBtr0089636
Feature type
Associated gene
Evidence Rank
Length (nt)
2457
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 49 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCGATAAGTTCTGTGACAACCCTGAAGCCGAAAACAAGCAGCCACGCTAGAGAAGAAAATCTGGTTGAAAATTGGCAAAA
          ATTCTAATTAAAAAATCGCAAAAGCCAAAAGAGAAGTTCGTAAGTCGTCCTACGAATTCCGCTGTGCGTCCCCACCACAT
          TTTGATTTCTCCAAACGTGCCAGACACCGAGCAGGGGACTTTTTTCACGGAGCACCCCGAATTGCAGCGAAGTAATTTTC
          GAATATGGCCGAGGACTTTGATGTGGAGGCGATGCTCGAGGCGCCGTACATGAAAAACAATGTCAGTGCGGGCAGCGGTG
          GAAGTGGTGGACGCAAGCGCAGCGGCAGCAGTCCAGGCGGCGGCGGTGGACACGATGACGACTACGCCGAGAATGGTCCG
          CGGAACGGCAGCGGCGGCGGAAGCTCACACAAAAAGCAAAGCAAACGATCCCGGAGTAGAAGCGGCTCGCGTGATGGCAA
          ATCTCGACGAGATCGCGGCAATGAACGCAGCAGTCATCGGGACAAGGATAAGGAGCGCGATCGTAACCGCGACGGCGGCG
          ACCGAGATCGACACCGCAGGGAAGGTGGCGATCGAGATCGGGAGCGGGAACGTGAGCGCGAACGCGACAGATCTCGTCGG
          AGTCGTTCGCGTGATGAGCGCGGTGGAGGTGGTCGCTACGGCGATCGTGACAAGGATCGCCGCTCGCGAGATCGACGCGG
          CGGCAGCAAGTCGTTGCAAGTGGATCGCTCGCGGGACAAGCGTCGACGCAGTCGTTCCCGCGATCAGCAGCGCAAACGGC
          TGAGTCCGATCCGTGAACGCAAGCGCAGCCATTCCCGCTCGAGGGACAGAAATAGCCGCCGTCGGGGAACCAATTCTCCG
          CGACGCCGCTCACCACCGAATGGAGCTGATCGCACCACGCCCACCGAACTCAGTCCCGAGGAGCGGGACGCCCGCACCGT
          TTTCTGCATCCAGTTGTCGCAGCGAGTGCGAGCCCGTGACCTGGAGGAGTTTTTCTCCAGCGTCGGCAAGGTGCGCGACG
          TGCGTCTAATCACATGCAACAAGACGAAACGCTTCAAGGGCATTGCCTACATTGAGTTCGATGATCCTGAGTCCGTGGCA
          CTGGCCCTGGGCCTCTCTGGCCAGCGGCTGCTCGGTGTACCCATCATGGTGCAGCACACGCAGGCTGAGAAGAATCGTCT
          CCAGAATGCAGCGCCGGCATTCCAACCGAAGAGTCACACGGGTCCCATGCGCCTCTACGTGGGATCACTGCACTTCAACA
          TTACCGAGGACATGCTGCGGGGCATATTCGAGCCCTTTGGCAAGATCGATGCCATTCAACTGATCATGGATACGGAGACG
          GGCCGATCCAAGGGCTACGGCTTTATCACGTACCACAATGCTGACGATGCCAAAAAGGCTCTGGAACAGCTGAACGGCTT
          TGAACTGGCCGGTCGGCTCATGAAAGTGGGCAATGTGACGGAGCGACTGGACATGAATACCACCTCGCTGGACACCGACG
          AGATGGATCGCACGGGCATCGATCTGGGTGCCACGGGACGTCTGCAGCTGATGTTCAAGCTGGCGGAAGGAGCCGGTTTG
          GCAGTGCCCCAGGCGGCTGCCAATGCGCTGCTGGCTACAGCACCTCAACCGGCGCCGTTGCAGCAGCAGGAGGTGGCACC
          ATCGATAGCCACACAGTGCTTCATACTGTCCAATATGTTTGATCCGCGTACCGAGACAAATCCTACCTGGGACGTTGAGA
          TCCGCGACGATGTGCTGGAGGAGTGCGCCAAACACGGCGGGGTGCTGCACATCCACGTGGACACCATTTCGCACACGGGA
          ACCGTGTATGTCAAGTGCCCGAGCACAACGACCGCAGTGCTGGCAGTGAATGCACTGCATGGACGCTGGTTTGCCGGTCG
          AGTGATCACGGCGGCCTACGTGCCCGTGATCAACTATCACACCATGTTTCCGGACTCCATCAACGCCGTCGATCTGGTGA
          CGTCCACGCGCAAGAACACCGACGATTGAGCTGAATGCGTGGGCAAAAATATTGTTAATATTCGTTACAAGAACTAATTT
          TTGGTCAAAACATTTTCAATTTTTTTAAAGACTCGACGCAAGCTGAAAATTAGGGGCACATATTAAAATACAATTAAATA
          CATTTATAAATATATATGAATTTGAAAATTTTAACATTTCTCGCCTTCAAGTAATTATGTCCGTGAACTATATTAATGTG
          TAGATTGCCTGAAATGCTGCAAGATCATGTTACAAATGGTTAATTACGTAGTTTCTAGTGCTTAATTTGTAATTTGCTAG
          TTTGACCGCCAAAAATGTAAGGACACCGACCGACCTATCGATTGTTGGCTTGCACGGAGCTTGATTTTAAAACATTGGAC
          ATTGTAACATTTCCCATACTTGTTAAGCCGTAGTTTTACTATACAGATATTTTGTAG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0089640
          2128
          FBtr0344708
          2623
          FBtr0344709
          2561
          FBtr0344710
          2453
          FBtr0344711
          3145
          FBtr0344712
          2484
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0088579
          594
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0088583
          594
          FBpp0311041
          21
          FBpp0311042
          21
          FBpp0311043
          22
          FBpp0311044
          22
          FBpp0311045
          22
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG11266-RB
          Caper-RB
          Secondary FlyBase IDs
            References (2)