Open Close
General Information
Symbol
Dmel\JhI-21-RB
Species
D. melanogaster
Annotation Symbol
CG12317-RB
FlyBase ID
FBtr0089656
Feature type
Associated gene
Evidence Rank
Length (nt)
2089
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 122 )
Sequence
AGTCGCTGTTCGCAGTCAAAGCCGTTTTGTTGTGTCCGCGCTCTCGAGTGACAATGTGCGCTATTCGCCATTAGAAGAGG
GTAAGCAGAAGAATCCCACAGTGCAGACATCATGACGGACCGATATGCCAATGGAGTGACCACCAGCCTGGTCGAGCCCA
CAAATGGATGCGCCGCGCCGGGTAATCCAAATCCCGCTGATGGCGAGGAGAAGATTGTCCTCAAGCGGAAGCTAACACTC
ATCAATGGAGTGGCCATCATAGTGGGCACCATCATTGGATCGGGCATCTTCATTGCTCCCACGGGAGTCTTTATTTACAC
CGAATCCGTGGGAAGCTCCCTTTTGATTTGGCTGACTTGCGGCATTTTATCGACGATCGGAGCTCTGTGCTACGCGGAAC
TGGGCACATGCATCACAAGATCTGGCGGGGATTACGCCTACCTGCTGGTGTCCTTTGGACCGCTGGTGGGATTCCTTCGC
CTCTGGATCGCACTGCTCATCATCCGGCCAACCACGCAGACCATTGTGGCTCTATCTTTTGCCCATTATGCGGTCAAGCC
ATTCTTTCCGGAATGCGATCCCCCACAGAATGCGGTGAAACTGCTGGCTGCCATATGTCTAACTCTGCTCACCACAATCA
ATTGCCTGTCGGTGAAGGTGTCCATGAAAGTGCAGGATGTGTTCACGGTGGGCAAGCTGCTGGCCCTCATCATGATTATC
CTGTCCGGACTGTACTACATGGCCACTGGCGAGCTGGAGAACTTCAGAAATCCGTGGGAGGGTATCTACACGGCCCGCAA
CATTGGCTACGCCTTCTACTCCGGTCTGTTTGCCTTTGGTGGCTGGAACTACTTAAACTTTGTGACGGAGGAGCTACAGG
ATCCATACAAGAATCTGCCGCGCGCCATTTGGATAGCCATGCCCCTGGTCACGAGCATCTATGTTCTGGTCAACTTGGCC
TATTTCGCCGTGGTAAACAAGCCGGAGATGCTCAGTTCGCTGGCCGTGGCGGTGACCTTTGGAAACCGAGTGTTCGGACC
GCTGGCCTTCATGGTGCCCATTTTCGTGGCGCTAAGCACATTTGGTGGCGTCAACGGGGTGCTCTTCACATCGGCGCGCC
TTTTCGCTACTGGGGCTCAGGAGGGGCATTTGCCCAAGTTTTTCCAGCTGTTCCACGTGAAACAACAGACGCCCATTCCC
TCCCTGATTTTCACGTGTCTTATGTCGCTGCTCATGCTGCTCACGGATAACGTGTACCAGTTGATCAACTACTTCAGCTC
GGTGCTCTGGCTCTCAGTGGTGGCCAGCATAGCCGGAATGTTGTGGCTCCGGCATAAGAGGCCCGACTTGCCCCGACCCA
TTAAAGTCCATCTTGCGCTGCCCATCACCTTCATGGTAAGCTGCGTGACACTCGTACTGCTGCCCAATTTGGAGGAGCCA
CAAAATCTGCTCATTGGCATCGGCATAACCCTGGCTGGCATTCCGTTCTACTACGCCTTCATCGCCCGAAAAAAGAAGCC
CAAGTGCTACGGCCGATTGTCCAATTCCGTAGTGGAGATTTGCCGGGCCATCTTCAATACCACCATTATCGAATCGAATG
AGGCTATTAACTAGGCCTACATATATGTGTGTACCACAACCGTAGAATTTATGCATTTAGTTAAAAAAAAACACTCGTAA
TTGATATTCGAAAAACGTGAAACTGAAAACTTGTTAAATTTGAAACCGTTTTAAGTGCCGTTTGTATGATATTTTAGCAT
TGCTCATCACCAAAATTGGCGTCGATTAGAATTTAGTTTTTATCGTATGTACGTATTTATTTTTTTTTTAGCGATCCCCT
CAGTTAACAGGTTTTTGCAAAACCCCCGCCTTTTTGGCCCACTTCCCACAAAAGTTTACTTTTTATGTCTATGGTTAGGT
GCAACAATCCGAATTCCTTTGTTAAAACAATCAGGAAATAAGTGAATGCGCTTATATGGGAACAAACTACGAATATGTAA
CATGTTTAGGGAAGCTACACAGCTAGCAGTACAATAAGGAGCATATTGATGTTTAAACATAACCGCTTAGCAAATAAATG
TATTATTGC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0089655
2125
FBtr0305089
2149
FBtr0342608
2119
FBtr0346427
2182
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0088925
500
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0088598
500
FBpp0293626
500
FBpp0309548
500
FBpp0312092
500
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG12317-RB
JhI-21-RB
Secondary FlyBase IDs
    References (2)