Open Close
General Information
Symbol
Dmel\larp-RB
Species
D. melanogaster
Annotation Symbol
CG42551-RB
FlyBase ID
FBtr0089682
Feature type
Associated gene
Evidence Rank
Length (nt)
6757
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 70 )
Sequence
CCCGATGTGGTGCACTTACGCAGATCCCAGAGATATACAAATATACATAGTATTCTTTTGAAAGTGGTGTTTTCTCAATG
ACTGGAAAACTGAAAAACGTTGGATACTTGAAGTTTTACTTATAGATATCGGCCAAACAATCCGGCAGCCCAAAGGCAGG
AACTTCTCCATTGGACAAACGTGTTTTGCAGCCAAAGGCACAGCAGCAGCAGCAGCAAACTAAACAAACTGCCAGCCAAA
ACAACAACGCACAGAACACCGCCAGCAACAAAAAGACACAACAGCAACAACAACCCCAACAGGGAGCAACAACAACCACA
CAGACAACAACAGCAGCAGCAGCAGCAGCAACCGCAGCAGCAGCAGCAACAGCAGCAACCACATCAGCAGCAGCAGCAAC
ATCATCCGCAGCAGCAGTACCAGCAGCAACAACTGAAACCGCAACAACAACCACTGTTGATGCCAGCCAGGCGGATGCTC
TTGCCAAAGTCGTGGTAAAGGACAAAAAGAAGGTCAATCAAAAGGCCAGCGACTTTAGCAACGTTGGTGACTGGCCGACG
CTAATTGGCGGAACTTCTGGCAGTGGCAAAGCCACCAGCAACGAACCCAAGCGCAACCCAACGAAAAAACAGCAGTCAGC
CAAAACAGCAGCCGCAGTAGCAGCCAGCAGCAATACCACTTCAAGTGAAGTTGCCACAGAGTCTAACGTCGCAGGCACAA
CCAGCAGCAGCAACAGCAATCCCAGCAGCAGCACCACCACCACAAACACCACTACCAACAGCCAAGCCACAACTGCACCT
GTTGCCAGCACGAGTCATGATGCCAAAGCCCAGCGAGACGCTGAGCCAGCGGCCAATTCTGCTGCAGGAACTACTGGCAC
CGCTGCCGGGCCTGCCCTCACCAAGAAGATACCCAAGCACAAGTGGCGTCCGCTGCCCATCGATCTGGCTAAGTCCAGTC
GCCCCAAGCCGATTGGCGGCCGGCCAAATCGGCGCTTCAGCGACGATATTGCCGACCAGCGCCGTCCGCCGCGCGTCTAC
CACGACCGTCAGCCCGGTGCTGGAGGAGCGGGAGTCGAGTCGCGGCATCCACACGCTGGCCGGCATCCGTACGGGTCACG
CCCAGCGACTGCTACGTCCGAGCGCGTGGATTCCTGGCGTAGCAGCAGCAGCACCACCACCGCAGCGTTCGATGAGCAGC
GCTCTGGAGCAGCGGGTGGTGCCGGGGCAGCGGGAACGGGAGTTGGGTCAGCCACGCGCGGGCCGCGTCGCTACCGGACG
CCGTACCGTGGCGGGCGGCAAGGCCGGGGCGGATTCTCCCGACAGGGACCAGGTCGCCCGACTTATCGCATACCACGCCA
TCTGCTAGCTTCGGGCGAGTATGCCAACTATCTGCCGGCGGACGCCGCCGGCGCCGACTCGCAGTCCTCGTATGTGCTCA
TGGGCACCCACTACTTTGGCAACGTGCCCGCCGCCTACATCGAATTGGACGCTAACAGCATCAAGGAGGCCATCAAGAAG
CAAGTTGAATACTATTTCAGCGTCGATAATCTTACCGGCGACTTCTTTTTGCGCCGCAAAATGGACCCCGAGGGCTATAT
CCCAGTTACTCTGATCGCCTCGTTCCATCGCGTTCTCGCACTGACCACCGATGTGGCTGTGATCGTAAACGCCATTAAGG
AATCGGATAAACTGGAGCTCTTTGAGGGCTATAAGGTGCGCACCAAGACGACACCGACCACCTGGCCCATCACGGAAGTG
CCGGAGGTCAACGAAGGGGAACCGAAGGCTATTGGCACACTGGAGCAGGAGCAGTTGGAGCAGAATGATGGTCAGGAAAA
GCTGGAGGAGCAGACTGAGGCGGATTCCCCGCCGCCCATTCTCACATCGGCGATGGCCACAAAGCCGCTGAACAGCATTC
CGCCGCCGCCAATGCCGCGAAACCCCCAGAATCTGGTGCCCAAAATGTTGCAGGATAAGCAACAGTCGAGATCCTCGACC
ATTGCGGCTCTAAACTCTGTGAATGCGATCAGTGCGCTGACCCAGCAAGTGGAGGGTGGTGCCGCTGAGCTGGCTGGACA
TTTGAGTGGACTGGCTGAGAGTGTGAAGCCCAAGTCGACATCGACGCCAGACAAGAGAAATGCTGCTTCAGCGGGCAATG
GAGCTGGGTCAGCAGCTGCTTTGGTGGCGGAGCCGGAGGGCATATGGAAAGAGGTAAAGAGACGCTCCAAAACAAATGCT
ATCAAAGAAAACGCTACTACACCACCACAACAACAACAGCCACCGCTTTCACAAACGCTCAACAACAATAACGATAATGT
CAAAACGAACAACACCTCGTCCAAGTCCAAGTCCTCGTCCAACAACGCCCCATCCAACGCCTCATCATCAGCCACTGTGT
GTGTAACCACGAACAATGCTTCCTCAGCCACCAAAGCAACCACCAAAACCACAACCACCTCCACCGCCACTACCACCACG
AACAACAACATTAAATCTGGCAATGCTGCTTACTCCAAAACCCACTCCAAATCCTCATCCAAAACAGCTGCTCCGCCATC
CGCTCAGTGCCATGCCGAAAAGGAAGAACTAGACTTCCAGTTTGACGAGGAGCTAATGGACCCCCTACCCCCTGGAACCG
GACGCATCAACAACTTCACCGAAAACTTCTCCGACGACGACGAATCCGACTACGAGTTTGCCGATCGTGACATTAACAAG
CTACTGATTGTGGCCCAAGTGGGCCGCGCACCTAAGCACGAGGGCTACGACCGCACCGCCGACTTTACGTCGCGTACGAA
AATCACCCAGGATCTGGAGAACATCATCAACGATGGACTGGTTAACTACGAAGAGGATCTGTGGACCACCACCAATGTGG
TTGCCGATTACAAGACTGTCAATGTGATTTCCCAGGCAGACTTCGAAAAACTGGCTGGTGGTCGAAACAAATCGGTGTTG
CCGCCGCAGGTGGTGCCACCACCGCCACCATTTGAGGAAGATCTGGATGAAACCCTGGTGGGTGACACCACTCTCAACTC
CACGCTGAACAACACTCTCAAGTCCCGACGTGCCCGCTTCTATGCTGCTCCCAACTCGCACTCGATTGATCCCCGAACGC
CAAGAAAGAGGAAACTCCGTCACACCGCCAATCCTCCAGTGGAGGCCCACGTCGGTTGGCTGCTTGACACTGTGGAGCAT
CGTCCTCGCACCACCTCGATGGGTTCCTCGGCGGGCACATCGCCTACCGCCTCGTCGTACGGATCGTTCGGATCGTCGGT
GCCACAGTCGCTGCCCGTATTCCAGCATCCATCACATGCTCTTCTCAAGGAGAACAACTTCACCCAACAGGCCTACCACA
AGTACCATTCGCGCTGCCTCAAGGAGCGCCGGCGCTTGGGCTACGGTCAGTCGCAGGAGATGAACACCCTGTACCGCTTC
TGGTCGTTCTTCCTGCGCGAGAACTTCAACAAGAGCATGTACAACGAGTTCCGATCGTTGGCGCTGGAGGATGCCGGCAA
TGGTTTCCGCTACGGTCTTGAATGCCTCTTCCGGTTCTTCTCGTACGGCTTGGAGAAGAAGTTCAGACCGAATATCTATC
AGGATTTCCAGGACGAGACGATTGCCGATTATGAAACAGGTCAACTGTACGGCCTCGAGAAGTTCTGGGCCTTCCTGAAA
TACTACAAGAATGGTGAGAAGTTGGAGGTGCAGCCCAAGCTGGCCGAGTACCTGAAGAGCTTCAAGAACATTGAGGACTT
CCGCGTGGTGGAGCCGGAGATCAACGAGATGCTGCAAGGAGTGGGCAGCCTGAATCCAGGCCGCCAGCTCAATCGCCACC
GCAGTGTGTCGGAGAGCGATGGCACAGCTGTAATTGCGGCCGGCGGTCGTCGCCTCAACACGACCATCACCAACCGCAGC
GACTACGTGGGCAGGTTGCTGCAGCAACAGCACCAACAACAGCAGCAGCAGCAGCATCACCAGTATCAGCAGGGATACGG
CGGCTACAATCAGCAGCAAAACCGCAGGCGCACAGGCTCCTTCGGCAGCACCACAGTGCGCATTCGCAGCGGCTCCCTGG
GCAACAAGCCGCAGGTGGCCAATCGCAATCAGGGATCGCAGCACGAGTTGCGACGCGGCGGCAGCAATTCTGGCCTGGCG
CCACACAAGCGACAGCAGCAACAGAAGCCGAAGCCAGGAGCAGGATCACAGACAGGCTCAACACGTGCCACCACATCAGC
GGCAGCTACAGCAACAACAGCCGCATCAGCAGCAACATCAACAGCAGCGACGCCAGCGGTAACGGTATCTTCGGGGTCAT
CGTCGTCGAAGAAGTAGTTACACGATAATGCAGAGACACTTTTTGGATTAGGCTTAAGTTAATATCTACCGCTTAGTTTT
CAGGGGGCACTCGCATTTGATGGCTCCACACTCTTTTGTTTATTCATTCTTATTATTCTTTTGTAGTATTCGAGTCAAAC
GTAAAGTGGGAAGAGTTGTTAGCGTTTAGCATAATTAAGTGAAATTTTTGAAATTTGTTTATTGCAATTTGCCTAGCGCT
CGTTGGTTTAGTAGTTACGATTCCAAATGTTTGTTTCTCGCATACCCTCGACAAAAAACTAAAACAATGGTTGCTTACAA
AATGCTCAATGCTCACACAAAACACACACACACACATACCAATTACACACAGCGGGGTCTGTCTGCTTTGTACCAGTGCC
AACCAGCCATGATCTTGGAAAATAACGAAACGATTGCCCTTATTTTTTTTTTTTGTTCTGTTAATTATTCTCCTTATTTT
TTATGCGATGCAAAAATCAAGGCAAAGATTTTCCTACTTAGAGCAGCGTTAATAGTTGACGTAATGCCATGAACTGTTGT
ACTATACGATTAAAGTTAAAGCTAATAACCATAACAATAACGATAACGATATAACCTATGCAAATATTACCTAACGAAAA
CTGAAAACCAATCAATCGAAATTGATACGCAAGCAACAACAAAAACCAAATGATCTTAATGCAAATAAATTTTGTAAATT
ACGAAAGAACATATATATATATATATATATATATATAAACATATATAACTTTATATGCAAAGGTACACTGAAGCCATGAA
AACGCGTACATAAGAATATGATTACTAACTATAATTATGATTATTTTTTGTGTGTGTGACCTTAGCGCAAATGTAAAATG
TATTTGTTTAAGAGGCAGCGAGATCTTGTAATCCTTAAACCCAATTGAGGCAAGCGGGACTCAAGTGCCAGCGAATTTTA
GTTATTTAAGCATTTACCACAAGCCAGTCCAGCGCAATCGCAATCGCCAGCGGAGTAGGAATAGGAATCCGACTTGGACT
CGGGTCCACCATTATCACACTGCACTCTCCCCAGTCTATATCAATCCAATCTATCGAATTGGTTAAACCCGAAAACCTCA
GTACCCCGCCAAGCATTTAGAAGCATGTCAAAACCATTTATTTTTTACCTTTAGTTTTGCACTTGTTAACTTTTAATTCG
AGAAAGCTACGACTACAGAAAAACTTAGAAAAAAACAAAAAAAAAATTTAAAATCACACAAAAATTGTCAAGTCCAAAAA
AAAGTTTAAAACTTTAAAAAAACGAAAAGGCAAATCATGCAAACGAAAAAAAAACCATTCAGAAATAATGAAGTTTGTTT
CGCATAGTGAATAGACCTAAACTTAAACATACGTGAGAAATCAAATCTAAGCTTAATACGGATAACAACTATATATATCT
GCATATATCCAAACACATATAGAGAGACTTTAGAGCGTGACTGCTTTTGAAAATACCATAACTAAATAAGAGGCAAACGG
TGAAGTTGCAGAAGTTTGCAAAACTCTCTCAAGGTCCTTTAGCTCCTCGATTTTGCTCGCTCATCTAGCCTAAGCAAGCA
TACACACAACACACACTACAAACCACACAAATTCGAAGAGTGCAAAGAACGTTTCATTAAATATTATTTTGTTATCATTA
GATATCTGTAAATATATTTCCCAGCTTCTTTTTAAAATGTCGCCTTATCAATTGATACAATTTTATCCACACATAAAAAC
AATCACATCCGCATTGGCCAGACGCTTCTCTATCTGTATGAGCTTAACGATCCGATCTATCAATATTATAGATATTACAA
AATGAGAGAGATGTCCGACGAGACAATTCAATCGGCTGTTGTGTAATTATACATATGTAGTTCTGCCACAACTATTTTGT
TTTTCACATGAAGTGTTGACTTTAGTTTATGATAACACACAACCAACCACACTTGGATCACTGACTTTTATGTGCACTTT
AAGTTTGCAACTTTTATATGAATAATTTAAACTTAACTCTACGAATATGATACGATACACACAGACCTACGAAATGAACA
TAATGGAAACTCTATTAAAAGTAATTTTGTAAGCTACTTAAATATGAAAAATGCGAGAGGAAAAGTAAGCAAAACGAAAG
AAATGATTAATGTGAAAAACGTGATAGTTTAAACCATAAAGAGTAATATTTACTACTATTATTATATTAATAATTAATTA
TACGATGCATATATACATATATATATATAAATATATATGGATATGTATGTGTAAAACGGAAACCACAAAAATTTCTAAAC
TAACGTGAACAAAAAAAGTAAAAAATTTTTTTAAAATTTCCAACACAAAAAAATGTTAAAAACAATGAGTAGAAAAACTA
AAACAAAAAAATGAATAAAAAAAAACTTGAAAAAACC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0089680
6745
FBtr0301180
8064
FBtr0301181
6820
FBtr0306388
7070
FBtr0306389
7915
FBtr0306390
7919
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0088624
965
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0088622
965
FBpp0290398
1673
FBpp0290399
965
FBpp0297480
1409
FBpp0297481
1673
FBpp0297482
1673
Comments

GC splice donor site postulated.

Based on cDNA(s) that contain premature stop codon and/or downstream start; may or may not produce functional polypeptide.

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG14066-RB
Secondary FlyBase IDs
  • FBtr0301179
References (2)