Open Close
General Information
Symbol
Dmel\CRMP-RA
Species
D. melanogaster
Annotation Symbol
CG1411-RA
FlyBase ID
FBtr0089686
Feature type
Associated gene
Evidence Rank
Length (nt)
2575
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 81 )
Sequence
ACAACGCGAGTTCCAATCGGACCGAGAGTTAAATGTTTTCCGATTTTCAAACAGCGAACTTGTGCGTGCGTTAAAATTAA
ACTCGTTCAGCATTTAAATCGTGTGAGATCTTTGCCTTTTAACGACTATTGCCATGTCGACCAGCCCGAAACCGGTTAAG
AAGGTGCCGATTCACTTGCAGAGTGCCCAGAATCGCGTCTACATCAAGAATGGCGAGATCGTCAACCATGACAAGTCCTT
CAAAGCGGACGTGTACATCGAAGATGGAATTATCAAGTTTGTGGGTCCCTCCTCGGAAATAACGATACCTGGCGGAGTGC
GCACCATCGACGCCAGCGGACTGATGATCATTCCCGGAGGCATCGATCCCCACACCCACATGCAGTTGCCTTTCGGCGGA
GCCGTGGCCGTCGACGATTTCTACCATGGAACCAAGGCCGCCGTGGCAGGTGGCACCACCATGATCATCGACTTCGTTCT
GCCCAACAAACATGAGTCGATGATCGAGGCCTACGACAAGTGGCGCAGCTGGGCCGATCCTAAGGTATGCTGCGACTACG
GATTGCATGTGGGCATCACCTGGTGGTCGAAGTCGGTGTCTGAGGAGATCGGCATTCTGTGCAAAGAGCTTGGAGTGAAC
TCCTTCAAAACATTCATGGCCTACAAAGGACTTTATCAGTTGAATGACTCAGACCTTCTGGATGTGTTCGAGCGTATCAG
GCACCTAAATGGGGTTGCTATGGTCCACGCGGAGAATGGCGACATCATTGCAAAGAACACGCAGCGCCTTTTGGCCGAGG
GCATCAATGGTCCGGAGGGTCACGAGCTGTCGCGGCCCGAGGAGGTCGAGGCCGAGGCGGTGCACCGCGCCTGCGTCCTG
GCCCACCAGATGAAGACGCCGCTCTTCGTGTCCGGCCTCACCAGCAAATCCTCCGCCGAGCTCGTGGGTCGCGCCCGTCG
CAGTGGCTACTGCGTGTTCGGGGAGACGCTGGCCAGCTCACTGGGCCGCTCCATGAGCGCCGTGCCCAAGGGCGACCGCA
TCTACGCCATCACCAGTCCCCCGATCCGCGAATCCGCCGAGACACCCAGGCAGCTGATGAAGTCCCTGGCTTATGACGAT
TTGCAGCTGACTGGCAGCGACAATTGCACCTTCAACAAGGAGCACAAGGCGCTCGGAAAGGGTGACTTTACCAAGATTCC
CAATGGCGTCAACGGAGTCGAGGATCGCATGTCGCTGGTCTGGGAGAAGGGCGTGCACGCTGGGCTTCTGGATCCCTGCC
GCTTTGTGGCCGTGACCAGTACAAATGCAGCCAAGATATTCAACATCTACCCCCAGAAGGGACGCATTGCCGTCGGCTCG
GATGCGGACATTGTGATCTGGAATCCGAATGCCACCCGTACCATTTCTAAGGATACCCACCACCATGCCTGTGACTTCAA
CATATTCGAGGGCATGACTGTGCACGGCGTCTGCGAATTCGTCCTGGTGCGCGGACGGATCTGCGCCGAGCGCGGGAATG
TGCGGGTAGCGGAGGGCTTTGGACGTTTCATTCCCACACCAGTTCGTCCGCCGTTCGTATACGACATCATCGAGGGCAAG
GTGCAGTCGCAGCCGGAGGAGCAGCACGAGGAGAAGCAGAACGGCAGCATGGCCAAGCGGTTCGCTGAGCTGGACATACA
GATTCCGGTGCAGGAGCCCATCAGCGCCATGCTGGCTGGCAACCTAGCCATGCCGGCGGAGGGATCTCTGTGCAGCACGC
CCTCGGTTCGTGGTCGCGTCGATGGAAAACGCGACTTGCAGGAGTCTTCCTTCTCCATAAGTGAGGAGCTCGACAGGTCT
GGTGTTCGAGCGTGCATCAAAGTGAAGAACCCACCTGGCGGAAAGTCTTCTGGATTCTGGTAGATCACAGACCCGATGTC
GCATCGCAAGTCGTGTGGATGCGGAATCGCACAATCTCCGACGACAGTGTAAGCCAAAGTCTGCGCTCATTCGACAACTA
AACTGGCATTTAATATAGATCCCTGAAACAAAATCGTAATCTAATCAAATTTCAAATAAGTACATAAGAGCATAACCACA
AACCAATTAAGAAGGTATCATAGACTCTGCTTCGTCATTTTGTATTTAGAACCGATTGCCTCTTGTTGATACAATTTTTG
TTAAGATCATCAATTGAATGAAATGCATCAAAGCATTTGAAGTCGAAAATCAAACATTATGGCTGCTTAGGTATTTTTCG
CTGAAATCGTTTATTTTAATACTTTGTTTATTTACAAGGAGATTTAGCACAATTTAACTCTGTTAAATTCATGACACTAT
TGCAATTGTTTATTGATTACCCGATTCGAAGTAGAGCACATCGATCATGCCACGTGAGACAAAGAGTGCTTGGGAGCAAA
TTCGGCATTTAATCTGAGGATGTCTAAAAGTAATACTTCAATCGATTTTTTGATAAGAAAAAAGTATAAATGTGGAAAAC
TATTTATTATAAATATACATACTTTATATACATATAATATTTAACAACAAAAGCCGAACACAAAGATCAAACTAATAAAC
TTTACCAAAAGATAG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0089685
2814
FBtr0114453
2590
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0088628
589
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0088627
332
FBpp0112945
594
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG1411-RA
Secondary FlyBase IDs
    References (2)