Open Close
General Information
Symbol
Dmel\REPTOR-BP-RB
Species
D. melanogaster
Annotation Symbol
CG18619-RB
FlyBase ID
FBtr0089737
Feature type
Associated gene
Evidence Rank
Length (nt)
627
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 17 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTTGTTTATTGTTACCTTGAGTATTTACGAAAGACGCATAATAACAAAGAGTTGCAAAGTTGTTGTATTATTTGAGAGTT
        ATAATGGCTGATATGGAGATACAGAGCAACAAAATGTCAATAACGGAGGAAACACAAGTGACGCGCAAGGAATGTGGAAA
        AAGGGGACGAAAACCAGGAAGAAAGACGTCTACTGAAAAATTGGACATGAAAGCCAAACTAGAACGCAGCAGACAAAGTG
        CCAGGGAATGCCGGGCGCGCAAGAAGCTGCGGTATCAGTACCTGGAGGAACTGGTGGCGGATCGGGAGAAGGCTGTAGTT
        GCTTTGCGTACGGAACTGGAGCGCTTAATTCAATGGAATAACCAGTTGAGCGAAAGCAACACTCCAACCAACAATGACCA
        GTTACTTCAGGAACTCGGAATCCTCAAACAAGAATAACCTACATTCTTATTTTTAGCTTAAGAATATTACTTTTATAATA
        AATGTACGACGGTTACTATTTATATTATTACGAAAATACTGCAGAAATTTTTGTTATTTTCTATATTGCATTTTACAGCT
        TTTTATTGTTTCATTTGTATAGTGATTAAAGCCAAATTAAAGTATTTTTATGATAAATAAGAACTAA
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0089738
        512
        FBtr0089736
        516
        FBtr0089735
        634
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0088678
        117
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0088679
        118
        FBpp0088677
        93
        FBpp0088676
        94
        Comments
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG18619-RB
        REPTOR-BP-RB
        Secondary FlyBase IDs
          References (2)