Open Close
General Information
Symbol
Dmel\dj-RB
Species
D. melanogaster
Annotation Symbol
CG1980-RB
FlyBase ID
FBtr0089741
Feature type
Associated gene
Evidence Rank
Length (nt)
1132
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 3 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CCACAGACAAATAGTCTCCAGCTGTGGTTTTTTCAAAATTCTTTGTAAAACTTTTGGTACAAAATTTAAAAATTTTTCTC
          GAAATGTTTAAGAGAACCGCTTTAATTTTACGTCGGTGCTTTCAGCCCACTTTTATACGGCCTCACCACATCAATGTCCT
          TGAGAACTTTAAGGAAGGGGCAAGCAAAATTTGTCGATGTCTCTATTCACGATCCGCAACACATTCGTTCTGCACTCGTC
          AGTCCAATGCAACGAAAGTTCTTGCAAGACCTGGAGCAGCAACAGACTGTTAGGATCAAGTGGTTTAAGGAAGGGAATCA
          GGATGAACTTGAAAACATGAAAAATGAATGCCGGAGGCTAGCTCTAGAAATCATCATGGCTGCTAAAGGTGGCGACATCA
          AAAAAGCCTGCAAGGAACTGGCTGAAAAAGAAAAGTGCAAGCAGATAGAACTGAAAAAGAAATGCAAGGAATTGGAGAAG
          AAGACGAAGTGCGCGAAGAAAGACCCTTGCAAAAAGAAAGATCCTTGCAAAAAGAAAGATCCCTGCAAAAAGAAAGATCC
          TTGCAAAAAGAAAGATCCTTGCAAAAAGAAAGATCCCTGCAAAAAGAAAGATCCTTGCAAAAAGAAAGATCCGTGCAAAA
          AAAAGGGTGGGGACCTAAAAAAGAAGTGCAAAAAATTGGCCGAAAAGGAAAAGTGCAAAAAACTGGCCAAAAAAGAAAAA
          ATGAAAAAGTTGCAGAAAAAGTGCAAAAAAATGGCTCAGAAGGAAAAATGCAAGAAAATGGCTAAAAAAGACAAATGCAA
          GAAAAAGTGAAGCTTTCGCGGATTATTCAATGAAATACATACGTACCTGGTTTAATTCATTCAGCTCTGTTCAACGCGGC
          TTTATCTAAAATATGGTTTTTTCATAATATACAATACGGCATTTTACCGAAAAATTAGATTTTATTTATTTAAAAAAATA
          ACAAGGGGGAAAACAGTTAATGAGCATGTAACCCCCAGCTTTCGAGTAATGAGTCCGTGGCAAGATTTCGTCGTTCATAC
          GGACAGACTGATAGTCAGACGGTCATGTTTGTTAAGGAATCTATCTATATATATATATATAGATTTATATATCATATAAA
          TAAATATGATTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0089742
          1152
          FBtr0305962
          1209
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0088682
          218
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0088683
          248
          FBpp0297104
          187
          Comments

          Annotation of isoform B is based on accession O01352; U90537.

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (3)
          Reported As
          Symbol Synonym
          CG1980-RB
          isoform B
          Secondary FlyBase IDs
            References (2)