Open Close
General Information
Symbol
Dmel\glo-RA
Species
D. melanogaster
Annotation Symbol
CG6946-RA
FlyBase ID
FBtr0089919
Feature type
Associated gene
Evidence Rank
Length (nt)
2117
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 80 )
Sequence
TTAATTGCGGTCACACTGCATCTTCAACTTGACGCGTGCTATTTGATTAATCTCTCTGAAAAATAAGTCAAATTAACCGA
TAAAGTTTAAAAAAAGGCGATATTGGAAGTTGAAACAGAGCAGAATACGGTAGAGATCTGGTGAAAAATGTCCAACGCAG
ACGTGCAATTTAACTACGGCCAGCAGGGAAATGGCGACAACTTCAACGACGACAGCAACCAGCAGCAGGATGAGGATGAC
CAGTACAACGAAGATGGCGGCGGCAAGATCGAAAACGTCGGCGAGAGCCCCAAATTCGTTCGGTTGCGCGGCCTGCCCTG
GTCCGCAACGCACAAGGAGATACTCGACTTTCTGGAAAACGTGAATGTGACTAATGGCTCGGCGGGCATTCACCTGGTCA
CCAGTCGGGTCGACGGCAAGAACACCGGCGAGGCGTACGTGGAGGTGGCCAGCCAGGAGGACGTCGAAGAGGCTCGCAAG
CTGAACAAGGCCAGCATGGGTCACCGCTACATTGAAGTTTTTACCGCCACGCCCAAGGAGGCCAAGGAAGCCATGCGGAA
GATCAGCGGACACGGCACGGCCTTCGTTGTGAAGCTTCGTGGTCTGCCATATGCCGTCACTGAGCAGCAAATCGAGGAGT
TCTTCTCTGGGTTGGATATCAAAACGGATCGGGAGGGCATACTTTTTGTTATGGACAGAAGGGGTCGTGCAACTGGGGAA
GCTTTTGTTCAGTTCGAAAGCCAGGACGACACTGAGCAAGCCTTGGGCCGAAATCGGGAAAAAATTGGGCACAGGTATAT
TGAGATATTCCGCAGCTCGATTGCTGAAATGAAGAGGGCCACAGGCGCCGGTGGCGGTGTCGGAGGACGCCCTGGCCCTT
ATGACATACGTGATCGTGGTGCCAACCGTGGTGGCAATGATTTCGGCGGAGGGCGCAATGATTGGGGCAACAATGGCAAC
TTTGGCGTTGGTGCCAACAACATGCTGGGCTTCAACAATCTGCCAAGCCTGATGAACTCGGGCAACTTTGGAAACAACCA
AGGTGGAAATAATGGAAATTTTGGAAATAACTCTGGACCCAGCAATTTCGGCAACTTTGGTGGCGGCAACAACGGTGGAA
ATTCCGGCAACTTTGGAAACGACAGTGGTAACAGCGGAAACTTTGGAAACTTCGGCAATAATGGAGGCGGAAACTTCGGC
GGCAACAACAACGGCGGCGGTGGTTTCAACAGTGGCAACAACTTCAATTCTCCAGGTGGCGTTAATAATTTCGGCAACAA
TGGCGGCTCCAATTTTGGCGGCAATGGTGGAGGAGGTTTCAATAACGGCGGAAACTTCGTATCCTCGAGTGGTGTTGGCA
ACTTTGGCCCGATCGGCGGCGGTCGCAACAATAACAACGGAAATTTCGGAAACTCTGGATTCGGTAACTTTGGAGGAAAC
AACAATGTCGGCTCGAACTTCGGAGGAGGCAACAACGGCGGTGGCGGCGGATTCAACAATGGCTCGAACTTCGGCGGCGG
CAACTCAATGGGCGGTGGTGGCAATTTCGGTCCCATCGGCGGCGGTCGGGGCAACGACATCGAGTATTATACAATCCACA
TGCGCGGACTTCCCTACACTTCATTTGAAAACGACGTTTTTAAGTTCTTCGAACCAATCCGACCAGCTAACGTGCGGATA
AACTACAACAAGAAGGGTCTGCACAGTGGCACTGCGGATGCCTACTTCGACACCTACGAGGATTCCCAGGTGGCCATGAA
GCGCCACAGAGAGCAGATGGGTTCGCGATACATTGAGCTGTTCTACGACGGAAAGACGCGTGGACTCAATGGTGGGGAAC
ACGGCGGTGGTAACGGTGGCGGCGGAATGGGAAACAATGGCGGCGGAAACTTTTCGCGGCGCATCTAAAGCTCTTCCATA
GTTTGATTACATTGAAATTAATGTAGACGCAAGTATTTCGTAATATTATGATCAAGCTGATACTGCTAAACCGCTAAGGA
ACCCTTACAACCATGTAAACGACTTAACTATCGAACAGAATTCAGACAGAGACAATTGGTTACACATAGAAACCACCAAC
GTATAATCAAGAATAAAGAGCACACTTTTATTTAAGT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0089917
2129
FBtr0089918
2059
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0088858
586
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0088856
586
FBpp0088857
179
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG6946-RA
glo-RA
Secondary FlyBase IDs
    References (2)