Open Close
General Information
Symbol
Dmel\Zip99C-RE
Species
D. melanogaster
Annotation Symbol
CG7816-RE
FlyBase ID
FBtr0089921
Feature type
Associated gene
Evidence Rank
Length (nt)
1537
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 24 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GTTTAGTCTGTTTCTGCACATTGGAAGCGTCGGTTATCGAGCTTGGAAATTAATTTTCGCCCAATTTACAATCTGTTTTG
        CCGAGTCATCATCGATCACGGCACATACTCCACCGAAAGTCACTGGACATGAGCAGGCAGCAGTGACTGAAGAAACCCAA
        CCCAGTTCCAGCACAGAGCAGCGCATAAGTAGCCGTAAAAAGGCAGCCGAAAATGACCACGAACAGCAGCTTCTTCGATG
        AACACATCGCCATGATATACTCCAACCTGATGGACCAGTACATGCCCGAGTACTTCAAAAGCTTTGAGTACACGCCATGG
        GTTTTCTCCCTGCTGGGATCGGTGGTAATTGGACTGAGTGGCATATTCCCGCTGATCATCATTCCCACGGAGGAGAAAAT
        GGCTAAGGAGGGATACAAAGATCCTGCAGATTCAAAACTCCTGCGAGTGCTTCTGAGTTTCGCGGTCGGCGGTCTGCTGG
        GCGATGTGTTCCTTCACCTGTTGCCAGAAGCCTGGGAGGGCGATAATCAAGATCCTTCTAGTCACCCATCCCTGCGCTCG
        GGCCTTTGGGTACTTTCCGGCATACTGATCTTCACGATCGTGGAGAAAATCTTTTCCGGATATGCCAGCGCGGACGAGGA
        GAACCCTCAGCCCAAGTGCGTGGAGATAGCCAACTGCCTGTTGCGTCGACATGGCGGCCAACTACCAGAGGGCGAAACCT
        CTGAGAGTTGTGGCGGCGCCTGCGACATCGAAGATGTAGGTAAAGTCTGTTTCCTACGCGAGCAGGAACAGAAGTCAAAG
        GAAAGGAAGGAACAGCCGAAGAAGGTGGCTGGTTATCTGAACCTCTTGGCCAACTCAATTGACAATTTCACACACGGTCT
        AGCCGTGGCTGGATCCTTTTTGGTGTCCTTCAGACACGGCATTCTAGCCACTTTTGCCATATTGCTTCATGAAATTCCGC
        ACGAGGTGGGGGATTTCGCAATCCTGCTTCGATCCGGATTCAGTCGCTGGGACGCCGCGCGTGCGCAACTACTCACGGCG
        GGAGCTGGCCTGCTCGGTGCTCTGGTGGCCATCGGAGGCTCCGGCGTAACGTCGGCCATGGAGGCACGTACTTCGTGGAT
        TATGCCGTTCACCGCCGGCGGCTTTCTGCACATTGCTCTGGTCACAGTATTACCTGATCTCTTGAAGGAGGAGGAGCGCA
        AGGAGTCCATTAAGCAGCTGCTAGCACTGGTATTTGGCATTGCGTTAATGGCCGTGATGACCATGCTATTCGAACACTAG
        GAACTTTAGCTGACAGCAGTATAAGAAGAAAATTGAAAGCAGTTTTTAGTTTGTTCTAAGATTGTCATTGGCAGTTTTAA
        ATTAACATGAATTTGTTGTACTTTATGGGATTCGACATCCTGTCTGCGTTATGTAATTATAGCCAATATGAATGATATTT
        AAACTATTATTAATGATTACGTATTACTGTATCATACTTATGAAACGAAAATTCAATAGACATTTAAGGGAGAGTCCTTT
        GCCCTCCACTATCCACG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0089923
        1531
        FBtr0089920
        1570
        FBtr0089922
        1492
        FBtr0089925
        1820
        FBtr0089924
        1539
        FBtr0303032
        1476
        FBtr0303033
        1709
        FBtr0303034
        1638
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0088860
        355
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0088862
        355
        FBpp0088859
        355
        FBpp0088861
        355
        FBpp0088864
        355
        FBpp0088863
        355
        FBpp0292151
        355
        FBpp0292152
        355
        FBpp0292153
        355
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG7816-RE
        Zip99C-RE
        Secondary FlyBase IDs
          References (2)