Open Close
General Information
Symbol
Dmel\Tm1-RI
Species
D. melanogaster
Annotation Symbol
CG4898-RI
FlyBase ID
FBtr0089961
Feature type
Associated gene
Evidence Rank
Length (nt)
2501
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AGACTGGTCACACTGCCCCATCCAGCAACAGCTGGTTCCAGTAAAAAAAATTCACGTAGCAATTTTGGCCACAAATTACC
      CAAAAATTAAAAAAAAACACAAGTGCAGCCGCAGTCGGGCAAAACAGTTGCCAAACCGAAACAGAGGCAGCAGAAACAAT
      TGTTCAAAAGTGATAAGGCGAAGGAGAAGTCCAGCAGGCAGCAGAGAAAGCGAGCCGGCACCAGGAGCACTCGCAATCCG
      AGGACGCAATCGGAATCTTCGGGCCTGTCATCCCGTTGGTGTTCCATCGAAGAGCAGTTGAACCTGCTGGACGACCTGCT
      CTACTACTGCGATGAGGAGGCCGAACTGTATCTAGCCCAGCTGTACGAAAGGTTCGAGACACTCCGGCGTAGCAGGAGTT
      CCTCGCCAGTGAGCGATTTCTGGAGCGATTCCGACATGGAGCACGATGACTCCAGCACCAGTGGCACTGGCAGCCATACA
      GCCAGCAATACCAGTCTAGTTCCCGCCTCGCTGAAGCGTCGTGGCCACCAGCATCATCCGCGATTCTCGGGCACTCGCCG
      TCCCAATGTGCCCAATGTCCAGGAGATTCTGGCCGCACTCTATCGTGGCGACTCAAAGAGCGCCCTGTCCAATCTGAGAG
      GAGAGACGCAACCGGAGGAGGAGCAACCACAGCAGCAGACGGAGGAGGTGCTGCCACCCAGCAGAAGCACTTTAAGCCTG
      CCCCTCAGTGAATCGGTGACCAATTCCCTGGGCAGCAACAGTCCCACGCCCACAGACGAAAGCAGCGTGCAAGATGAGGG
      GGCCAGTAATCCGGCAGCAGCTTTAATAGCTGAGGATGCAGCCCCACCAGCAGGCACAACCACGTCCAAGAGCAAGAAAA
      AGAAGCGGGAGAAGGGTGAAAGGTCAGAGAAATCGGACAAATCTGAGAAATCCGACCGGAAGAAGAAATCTTCAGGCAAG
      AAGGAACGCAGCAAACGATCCAATCCCATGGAGCAAAGCAGCGACAGCCTGGCCACCGATCTCAGTGCCGGGGCCATCGA
      TGAGGGCATCGCACTGGCCGACGACGATGACAACCAAGCGGCGGAATGGTCCAAGTTGCGATGCACCAGCGAGGCGGCCG
      AGATTGTGGCGGAGCGGGAGGCTCGACGGAACAAGGGACGTTGTGCGGATTATCCGGGACTCGCCTTTGGCAGATCCATC
      TTCAGTTCGGACACCATGATGAAGTTCAACATCATCCGCAACGAGCTGCACAACATCATGAACACACAACTCAAACGGGC
      CGAATCCGAGGTTGCCGCTCTGAACCGTCGCATCCAGTTGCTCGAAGAAGACTTGGAGCGCTCTGAGGAGCGTCTGGGCT
      CCGCCACAGCCAAGCTGTCGGAAGCCTCTCAGGCCGCCGATGAGAGCGAACGTGCTCGCAAAATTCTTGAGAACCGCGCC
      CTTGCCGATGAAGAACGCATGGACGCTCTCGAGAATCAGCTGAAGGAAGCGCGTTTCCTTGCTGAGGAGGCTGACAAGAA
      ATACGATGAGGTGCAGCTAAAAACCAATTTGTCTTCTATTAAGCTAAGCAACAATAACAACAACAGTAACAGTAACAATA
      TTGAAATCAGTAAATCAGAATCATGCAATGCCAGCGATATTGGTGGCACCAACAACAATAACGCATCCAGAACTATTGCA
      TCTGCTGCTGTTGGTGAAGAGACTTCCACCTTGTCCTCCACAAGCCACGAACACAACAACAATCCCAACAACGACACCTG
      ATCTGGTTCCTTTGTCAAGCGGATATTAAAGTAACTTGAATTTGAATTGAATGATTGATAAAGGGTTAACCGAAACCCGA
      ATCTTGGCACAGGAATCAGCCAGTGCGTTGATGCAAAACTTGTGCTTACCACGACGATTACGAATGATGCTTGAGGGCAG
      TTAGAGCTTAGATCTAGACCTAGATCATGCACAGCCCGCCCGCCCGCCTGACCATATGCAATATATATACGTGTATAGAT
      TATGACGATGATAATGATGATGATAATGATGATGTATTAGTCGATGTACATATGTACAATGTAAATCCAATCCAATGAAC
      TTTCGATTGTAATGGAGTTTCGTGTGTATTTTAATGTGTAAAATACCAATGGCAATATGTAAAGTAATTGTTAAGCGGTC
      CATACAATGTCCACAAGTACTCTATTAATTGTCCTCAATGCTCTTCCACGTCAAAAAGCTTGAGAAGCATATCGCCACTG
      AAAATTGATTGTTAAAAGTAAATCGTAATTGGGTTAGTTTCTTAAATTGTTCTTTTTATTTCCATTCAATTTCCAATTAC
      ATAATTGTAAAGAAAATGTAATTTATACTCACGTTAAATGCATAGAGAAACACACCTTAAGTTTAAAATTAACCCAAGGA
      AATATCTAATTTTGGAATAATATTTTTGCAAATTATTGTTTATATACATAACATATTATATACTACAAAAATATATAAAT
      ACAAATATATAATTGCAGCAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0089960
      2003
      FBtr0089962
      2651
      FBtr0089965
      2531
      FBtr0089959
      1684
      FBtr0089964
      2485
      FBtr0089963
      3054
      FBtr0089967
      1248
      FBtr0089957
      1665
      FBtr0089968
      2194
      FBtr0301959
      1253
      FBtr0301960
      1253
      FBtr0305654
      1503
      FBtr0305655
      752
      FBtr0305656
      1318
      FBtr0333917
      1861
      FBtr0333918
      1253
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0088900
      441
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0088899
      252
      FBpp0088901
      441
      FBpp0088904
      711
      FBpp0088898
      501
      FBpp0088903
      285
      FBpp0088902
      678
      FBpp0088906
      285
      FBpp0088896
      518
      FBpp0089024
      284
      FBpp0291171
      285
      FBpp0291172
      285
      FBpp0296934
      285
      FBpp0296935
      161
      FBpp0296936
      250
      FBpp0306045
      250
      FBpp0306046
      285
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG4898-RI
      Secondary FlyBase IDs
        References (2)