Open Close
General Information
Symbol
Dmel\Vmat-RE
Species
D. melanogaster
Annotation Symbol
CG33528-RE
FlyBase ID
FBtr0091491
Feature type
Associated gene
Evidence Rank
Length (nt)
7325
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 52 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GCAGTCGTTCGCCGTCGACGTCGCAGGCGCCTCGTGCGCCGCTGGCCAGCGGCATTCAGCGCAACTGCGTTCAGTGCGAG
      ATGAGATCTCGTGGCTGATGGACGTGCCCGTTTCCCACGCTCGCAGTGCAGCCTCAGCACCAGAAAAGACACTTGTGGCA
      CTCACTCGCAGTCAGCTGCCGTTCTAGCACTAGTTTAGTTTTAGTTTCCAGCAACAAAATCACACGCGGCAATTCCAACA
      AATGTGCGTCAAAATCCGTGTTTAAATCGCAAGCACCACGCAAGCAAGCATCTTTTAAAAATATGTGAAAACTTCAAAGA
      TTTAAGGGTGAATACTCCAACAACGCACAACCTCACCCGAAAAAAATCCGGCTACAACAACTACCTGACTTCATCAACTG
      GCAATTTGCAATAGACTCATTGGCATTTAGCAGACCACAGACACAAAAACCCAACCCATTCGCCCAACGAAACCATTTTT
      CCGCAGAATTTCCCCCAAAGAAAGCTAAACGAGTCGCTTATAAGAAATTACTCAGCAACCAGCGGCTAGCGACGCAATGC
      AATCATCGACCGATGCGGGCAATGGTGGACCAAGAAAACACACGCAGAGCACAGCCCCCCAGAAGCAGTCGGAGATTAGC
      GAGACCACCTCCTTCACCGTAAACGCAAACACCACCACCAACAGCCAGCAGCAACAGATTCCCGGCGGACCCGCCAGCAA
      TACGCCCAGCAAAAATCCCTTCAAGCAGCAGTTGGACAGCAATCAACAGAATGGCAATATGGAGCCGGATTGCGGCATCA
      TGGGCGTCGGCAAGGAGCCACCGGTACCGCCGCCGCCCACCTACCAGTCGCAGACCTACGCAGGACGACAGGCTCCGCCG
      CCAGCGGATCAGTACCGCGAGGAGGATCCACGCGCTGCCGGGTCCTGGGCCGCCGCCAAATCCTGGATGGTCAGCTGGCG
      GGGATCCAATCGCCTGGTGCTCGTCATCGTGGCCATAGCCCTGCTCCTCGACAACATGCTGCTGACCACAGTGGTGCCCA
      TCATACCCGAGTTCCTGTACGACATACGACATCCGGATGCGCCGCTCGACAGCTTTCCACGCACACCTTTAACGTCCAAC
      GTTCCGCCGCCACCGACGCCGTGTCCATGCAACAAGGATGGCAGCGAGGCGGCTCCGCTCGAGATCTCCACGATTAGTCC
      GGAGGAGAACGAGACCTATTACCGGGAACTGGAGGAGCGGCACAACGAGCTGGTGGGCGAGACCGTCGAGGTGGGACTTC
      TATTTGCCTCCAAGGCGTTTGTCCAGCTGCTGGTTAACCCAATTGTTGGACCCCTGACTCACAGGATTGGCTATAGTATT
      CCCATGTTCGCTGGCTTTGTGATAATGTTCCTCTCAACGATAATTTTCGCTTTTGGACGATCTTACCTGGTACTGTTCGT
      GGCGAGGGCACTGCAGGGCATTGGATCATCCTGCTCCTCGGTTTCCGGAATGGGCATGCTGGCAGATCGATTTACGGACG
      ACAAGGAGCGTGGAAATGCCATGGGCATAGCACTGGGAGGATTGGCTTTGGGCGTGCTCATCGGTCCACCATTCGGTGGC
      GTGATGTACGAGTTTGTGGGCAAGTCGGCTCCATTCCTGATCCTGGCTGCCCTGGCCTTGGGCGATGGCCTGCTACAGTT
      GTTCATGCTGCAGCCATCGATCCAGAAGGCCGAAACGGAACCGCCCTCGCTGAAGAGCCTCATCAGTGATCCCTACATCC
      TGATTGCTGCTGGTGCCATCACGTTCGCCAATATGGGCATTGCCATGCTGGAACCATCGCTACCGCTGTGGATGGTGGAC
      AACATGGGCGCCACTCGTTGGGAGCAGGGCGTGGCCTTCCTGCCCGCCTCCATTAGCTACCTGATTGGCACCAATCTCTT
      CGGACCGCTGGGACACAAAATTGGACGATGGTTTGCCGCGTGCTTGGGATTGATTATCATCGGGGGATGCTTGATATTTA
      TACCCATGGCCACTTCGATCACTCACCTGATCATCCCGAATGCAGGACTTGGCTTTGCCATTGGAATGGTGGACTCGTCG
      ATGATGCCGGAACTGGGCTATCTGGTGGACATCCGACACTCGGCGGTCTACGGCAGCGTTTACGCCCTGGGTGATGTGGC
      CTTCTGTGTTGGCTTCGCCGTGGGTCCCGCCTTATCTGGATCGCTGGTGAAGAGCATCGGCTTCGAGTGGATGTTGTTTG
      GAATTGCCATACTCTGCTTTATGTATGCTCCATTGCTGACGCTGCTCAAGAATCCGCCGACCAGCGACGAGAAGAAGTCT
      TTGATCTATGGACGCGATCGGGCTCAGGTACGTTATGTAACCTATCAAAACTACGAGGAAGACGAATAAGCAAACGATTT
      AACTACAACGCAATGTTGCCAAAAGTGCAACCAAAAATCAAAAAAAAAAAAAACGGGTAATAAAATCAAGAAAAAAAAGA
      AAAGATCAGAGAGTAACCGTAACCACAACCAACAATATCAGTAATATCATATGAAAATCCAATCCAAATCGTTATTCTTG
      TTCAATGTTTTACCCAAGTTGCACTATAGTATTATACCATATCAAGAAGTAACCTCCCCCAAAAACTTTGCACATGTTAA
      AGTAGAGCACACAAATTTGTGAAGATAAAGAAAGAGAAAGTTGAGTGAAAGCAGGGCTCTGTGATGAGCCAGAAGTTCGA
      TGAGACGGGTAGAAAGAAATAAAAATAAGTAAGGATCCTAAGAACCCTACTACATATTGGAGGCAATTTAGTGGCCAAAA
      GGTTTGGAAACTATCTCAAAATGTATTTTTTTTTTAAGTACAGATATAGCATGATGTGACTGTACGAAGAGCTTAATGAG
      CTTGTGAGAGTCCTTCTTTGGAAGACTCTACTCCCAGCAGGGAAGGATTAATTGCCGATCCAACAAGCAGACGCCCGCAA
      TTGCAATGATTTAATGGAGGAATCCCAAGAAGCGAGGAACATATAGAAACTATAGTTTGGAATATAATTTTCGGATTTAG
      CTTAGTTAAGAACATTTAAAAGTCAAAAAAACAGCAATGATACAACTAATTTTGGCGCTATTCTAATATAGAAAAGTTAG
      GGGAGTATATGAGCGTCTTCTGGAACAGCTTAGCTCTATATTCTAGAGATGATCTGTTCCAAAAATCACACATATAATCC
      CCCACTTTTCCCTTATATTATTATAAACGCATCAAACGCAGTTTATCCGCATACACGCTGATGTTAACCTGACAGGAATC
      TTGGCTTTCCTGACTGCTGCTCCTTTCCGTGGGCGCTGGTGATGATCCCCTCATCCTCACATGGTTCAGACTGAAGGCTA
      GATCCGTATCCCTGGACCGAGATGTGGTTATCCTAATGGGCATATTATTCAGACAGGCGACGCAGGTTTGGTTTCCATTT
      AGCTGCTTTTGCTCACTAGCCCGGTCATTGGATGAACGCCTCATGCTGCAGTTGCTCCGTCGCCCGGTGGTGGTCACTGT
      GACATGGACATTGCCATTCGAAGTTCCCGAACTACTGCGAACTAGATCTCTTGGAATTGTAGGAGGGAATCGTTGGGAAT
      CGGGATTAGGTGTTGAACTGAAGCAGCGGTTTGACCTGCGATTTGGAGATGAGGAACGGGAGGTGGGTGTAGAAGACGGC
      GCTTCTGAAGAGGGTGATGGGGAGCTGCTATTCCGGGTAAGGATCGGCGGGGGAGTAAGTGAACGGGTAGCGGACGAGAC
      ACTTCTAGGATCCTGACATACTCTAGTCTTCCGTCTTTCTTTCGGTCTGGTCGGATTCTCCAATCGACGTGACCTTCGGG
      ACGATAGATCACAAAAGGCCATTCCGGGCAAACGATCATCAGAGGTGGTTGTGTACAAGTGCGAGGTCATTGGAACTGAC
      GGTCGGGGAGGTATGTTCTCTTGGCACAGTAGATCCATTTGCTCCCGACGCGCCTGCTCCTGGAGGGCACACAGCCGCTC
      GTATTCTCTGTGCCGCTGGTTTTCCCGCTCTAGTTCCCGCAATCGCTGCCTCTCGCGCTCCACTTCCAACTCTAGGAGTC
      GCTCCTCATCTCGCATGCGCTCCAACTGGCGGAGCTGCTCACGATCTCGCTCCCGCTGGCGGGCACGCTCTCGCTCCTCC
      TGAAGTTCCCTCTCCTGCTCCAAGCGTCGGTCCTCCAACAACTGTCGATCCCGCTCCCGTTTTTGTTGGCGCTCCGCTTC
      TCGTGCCTTCTCTCTCTGCCGGAGCTCCCATTCCGGACTCGTCCGAGGTTTCGTCTCGCTCACATTGAACTTGGACAGTC
      GCTTGTCGATGCCAAAGGTGCCGCTGGATCTGGGCGTACAGCGCACCGGTTTGGACTTGGTCCTCACCTTGTCCGTATTG
      TTCAGCAGATAGGCATCCGTTGCGATCTGGATGCTCACATTGTTGTCCACCTCAGATTGCGAACCCACACTGCAGATGTC
      GATGCTGATACCGCAGCCGCTTCTTCTGTTCTGCAGATGGGCGTTGGAGTCCATGGAGAAGGTGGTGGTTGAAGTAGAAG
      GCACACCGCCGCCAGCTGATCGTATGAGATTCGTGGTACTCTGGCACAAAGTCGTGTTGCTTGGACCCCGTCTCATAGCC
      TCGTAGCGCACACTTTGACAGCATGTCCTGAGGAGCGGCGAATCCGTGGCTGTGGGAGAACGCTTCGTCTGCGGAGCCAC
      CGGTACACTCTGTCTCTCCGGCGTTGTCACCGTAGATCCCAAGGGCATATCCATAGATTCCAGCAAAAGGCGACGCCTAT
      AGGAGCTAGTTTGTGGACTCTTTTTTGCCGGAATGTACTCGGGATCCTGGCTGAATCTGGGATTGTGGTAGAAGGTCTGG
      AAGGAGGCCTTCTTCACCAGTGCCGGCGGAGTCGGTGCCGCCGGAGGTCTTTGATAGTTCTGGACCGGATAAAATGGCTT
      GTCGGCATAGCGAAAGTTGTATGAGTGAATTTTGAAGGGGTCACCAATGAAGACGTCACTCGCCTGGCGACGCGAAGGAT
      CTGGGACAAAAGAAGGCCCTGGGAATTAGTTTTGACAGTGCTTTGAACCTGGAACAGCAACTCACTCGATATACGATTCA
      TTTGGGGCTGATAATTTTGAGTTTTCCAAGGTATGCGAGTTCGAAATTAGCGTGCCAATCATATAAATTGGATTTTATTT
      TTTAGAATATATTCAAATGAGTCCAAATAAATAAATTTTTTTTTCATAGGTCTAGAACCGAAAACCCAGGTAACTTTGGT
      TTTCGGTTCTGTCTATATGATTCTCGCTACTGAAATCCATTAAAACTTTTTGGCAATACGGCGTAGAAATTGGACGGAAT
      TAATGGGCACTACTCCACAACGGAAGCCCACCTTCCTTAAGTAAATCAATTTCATATTTCAAGTTGTTAAAGTTAAATAA
      AGTATATATATATATAATCATTGAATCTTGTAAAATTGTTGCCCACATTAGCACACACACAAGTTATCTGACAAAAAAAG
      GGAATATTTGATAGGCTTTTGGTGCCAAATGGTACGTGGAATATAAACACCATTCCATAGAATCTAAAAATATATACAGG
      GTCTATAAGCGTTCACAATTTTGAATAGAAGTCTTAAGTTGTATTTTAGTTTGCAATTATCTAGTGAGGAATAAAGTCGC
      TAAATTGGGTGTTCTACAAAATTTAGACTAGTACCCACTGATTATAACTTCAATTCTTCCCACCCAAAGTTTCGGATCTT
      AGCCCATAAATATTACCGACATTATTTCGTCACTTAACCAGATCGTATTGGATCGTAAGGATATTGCCGCAAGGCACTTG
      AATGGCTGCAAGTGTCCTTAAGCGTTGTGATCACCACGTAAAATCCTCTTTAAAACTAATGCTCCTCTTCATTTGGGCAA
      TGAAAATCATTATTTTGAACGCATATAGTCCCAGCAATTCTAATCGAAAGTAGTGTAAAGTAAACTATAGCTCTGTAATG
      GTCGAAAAAGTTTAAAGAAAGCCGACAAAATGTAGTTAATCGCAGGTATACAATGAGGTTATATTGACAAACTGTATATA
      CGAATAGCTGAAATACTTGCTGATTATCATCGTTGTTCTATTGTTGTGAAAGATGAATTACTCAACTAATATCCATAAAT
      TCTACGCTGTGTTCGTTATGACTTTTCACGCTTTGAAGAATTGCCGAATTCAATCATGCAACACGCGTTTAACAATTAAG
      GTACTCTTCAATGATTGCATATACAATATTACGACAACCTAAGAAAAAGACATTGTACAGGGTATGCAAATCCAACGTAC
      ATATACGATATTTAGCAAATGGTTTTGTTCGGTTTTCATAAAGTTGTTGTGTAAGTTTATGCTTTAGCTCCCCTTCTGGG
      GGCCCAGCATTCAATATAAACGTGTGAATTAGACAATATAGCTTCTAACTGAATAGTTCAGCATACTCTCAATACAAATA
      CATATATATTATGCGTAATCAAATCGTTATTGTTGCCTAACTATGTTCAAATGTTGCATAAGTGTTACGTAACTAACAAT
      TCACAAGAAAAAAAAGCTGGTATGGGGTCAAACAAACAAACAATGCTAATGCAACTAACCAAAGCGTTTTGTGCACAGTA
      TTCAAATATTCAAAACTATCCTTAAATCGATATACTCAACGTTTACTGTATGTATTTGCTATTTAAGATAATCGCACACA
      CATACTCTCTCTTCGAAAAAGTTCGTATTCGAATGACCGCAAATAAAACGTATAGTTTAGCGCGAGCATATTAGTCAAAA
      CAGTGTATGAAAAATATGTATAACAGGGCATATATATATATATATATATTAGCATTACTAACCACGTATATGTACTATAG
      TCCTTAAACGATTATCACATTTTTACTCAAACCTTGAAACTACATACATACACACATATGTACTCATGTCATGCCATGCC
      ATGTTTATAGGGTGAGAACCGGGAGAAACCAGAACACAAACATACTTATATGCTATTTATACATACCAATGGTGACCAAG
      TAGAATATATAACTATACTTAAACAAAAAAAACTACATATATACAAAACTAAATACCTACTATCAATACAATCAACTAAT
      ATATGCATTACCTATACTGTAGTCATTCGACATGTGTTTATTTTATAGAGATATTGCTAACTAAGCTGATACCGATATTG
      TGAAAAACCAAACTAAATTGCGTTGAGTTTAATATACTCGCCCATCAATAAATTTGAAACAATGCAAATGCAAAATACAA
      ATATGTAACTGAAGTTGTTGGTGAATAAACAAGCTACAAAACAAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0091493
      2470
      FBtr0091492
      2446
      FBtr0310062
      7141
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0090961
      610
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0090963
      610
      FBpp0090962
      646
      FBpp0301763
      610
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Encodes Vmat protein isoform A (FBrf0187873).

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (3)
      Reported As
      Symbol Synonym
      CG33528-RE
      CG6139-RC
      Vmat-RE
      Secondary FlyBase IDs
        References (2)