Open Close
General Information
Symbol
Dmel\Vmat-RD
Species
D. melanogaster
Annotation Symbol
CG33528-RD
FlyBase ID
FBtr0091492
Feature type
Associated gene
Evidence Rank
Length (nt)
2446
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 18 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTTTGAGTTCAGAGCGCCGACTTGTCGGTAGAATTGGAATCCGCGGAATGAACGATCCACCCCGAAAAAGATTCCAAAG
        TGAACCAATTGTGAAAAAGAAAGTGCAATCCAGACAAACATCAGCACTTCCCAAATGCAAAACACACAGCCTTAACTTGT
        GATTTTGATTTTGATCAACAGAGTCATCGGCTAATTGGGATTTCAGTGCGCATTTCTGGCGGCTTTCAGTGATTAGCCAA
        AAGCCATATAAATATCGGTCGTTAAAGCAGATTCAGGTTCATTAGTGCACGTGATATTCTAGGGGCGAGAGTTCAGTTTG
        TGGAGCATTAATCTCCAGATCTATTAAATCAGGAAAAGCTGCCAGCAACCAGCGGCTAGCGACGCAATGCAATCATCGAC
        CGATGCGGGCAATGGTGGACCAAGAAAACACACGCAGAGCACAGCCCCCCAGAAGCAGTCGGAGATTAGCGAGACCACCT
        CCTTCACCGTAAACGCAAACACCACCACCAACAGCCAGCAGCAACAGATTCCCGGCGGACCCGCCAGCAATACGCCCAGC
        AAAAATCCCTTCAAGCAGCAGTTGGACAGCAATCAACAGAATGGCAATATGGAGCCGGATTGCGGCATCATGGGCGTCGG
        CAAGGAGCCACCGGTACCGCCGCCGCCCACCTACCAGTCGCAGACCTACGCAGGACGACAGGCTCCGCCGCCAGCGGATC
        AGTACCGCGAGGAGGATCCACGCGCTGCCGGGTCCTGGGCCGCCGCCAAATCCTGGATGGTCAGCTGGCGGGGATCCAAT
        CGCCTGGTGCTCGTCATCGTGGCCATAGCCCTGCTCCTCGACAACATGCTGCTGACCACAGTGGTGCCCATCATACCCGA
        GTTCCTGTACGACATACGACATCCGGATGCGCCGCTCGACAGCTTTCCACGCACACCTTTAACGTCCAACGTTCCGCCGC
        CACCGACGCCGTGTCCATGCAACAAGGATGGCAGCGAGGCGGCTCCGCTCGAGATCTCCACGATTAGTCCGGAGGAGAAC
        GAGACCTATTACCGGGAACTGGAGGAGCGGCACAACGAGCTGGTGGGCGAGACCGTCGAGGTGGGACTTCTATTTGCCTC
        CAAGGCGTTTGTCCAGCTGCTGGTTAACCCAATTGTTGGACCCCTGACTCACAGGATTGGCTATAGTATTCCCATGTTCG
        CTGGCTTTGTGATAATGTTCCTCTCAACGATAATTTTCGCTTTTGGACGATCTTACCTGGTACTGTTCGTGGCGAGGGCA
        CTGCAGGGCATTGGATCATCCTGCTCCTCGGTTTCCGGAATGGGCATGCTGGCAGATCGATTTACGGACGACAAGGAGCG
        TGGAAATGCCATGGGCATAGCACTGGGAGGATTGGCTTTGGGCGTGCTCATCGGTCCACCATTCGGTGGCGTGATGTACG
        AGTTTGTGGGCAAGTCGGCTCCATTCCTGATCCTGGCTGCCCTGGCCTTGGGCGATGGCCTGCTACAGTTGTTCATGCTG
        CAGCCATCGATCCAGAAGGCCGAAACGGAACCGCCCTCGCTGAAGAGCCTCATCAGTGATCCCTACATCCTGATTGCTGC
        TGGTGCCATCACGTTCGCCAATATGGGCATTGCCATGCTGGAACCATCGCTACCGCTGTGGATGGTGGACAACATGGGCG
        CCACTCGTTGGGAGCAGGGCGTGGCCTTCCTGCCCGCCTCCATTAGCTACCTGATTGGCACCAATCTCTTCGGACCGCTG
        GGACACAAAATTGGACGATGGTTTGCCGCGTGCTTGGGATTGATTATCATCGGGGGATGCTTGATATTTATACCCATGGC
        CACTTCGATCACTCACCTGATCATCCCGAATGCAGGACTTGGCTTTGCCATTGGAATGGTGGACTCGTCGATGATGCCGG
        AACTGGGCTATCTGGTGGACATCCGACACTCGGCGGTCTACGGCAGCGTTTACGCCCTGGGTGATGTGGCCTTCTGTGTT
        GGCTTCGCCGTGGGTCCCGCCTTATCTGGATCGCTGGTGAAGAGCATCGGCTTCGAGTGGATGTTGTTTGGAATTGCCAT
        ACTCTGCTTTATGTATGCTCCATTGCTGACGCTGCTCAAGAATCCGCCGACCAGCGACGAGAAGAAGGTACGTATGGCCA
        GAGAGGCGGCTGAGGCTGCTGCAGCCGCTGCTGCCGCTTCAGGGGAATTCTCTGGAATACCCCAGATGACCGCATCCTGC
        CCGGCCATCATGCATGGTGCATCTGTTCCCGATTCGGATGCCGAGGCGGGCAGGACGAACGAGGCGTACGAGAGCGAGAG
        GCTTTGAGTCTCGATACATTGCTTAATTTTAATTTATTATTATTTTTCGTATACTTAGTCATTATCATTGTTTTTAGCCC
        TAAGTTCAGCTTAATTTGTTTGTAATAAAACTATTAATTTTTATTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0091493
        2470
        FBtr0091491
        7325
        FBtr0310062
        7141
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0090962
        646
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0090963
        610
        FBpp0090961
        610
        FBpp0301763
        610
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Encodes Vmat protein isoform B (FBrf0187873).

        Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG33528-RD
        Vmat-RD
        Secondary FlyBase IDs
          References (2)