Open Close
General Information
Symbol
Dmel\Vmat-RC
Species
D. melanogaster
Annotation Symbol
CG33528-RC
FlyBase ID
FBtr0091493
Feature type
Associated gene
Evidence Rank
Length (nt)
2470
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 36 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    GCAGTCGTTCGCCGTCGACGTCGCAGGCGCCTCGTGCGCCGCTGGCCAGCGGCATTCAGCGCAACTGCGTTCAGTGCGAG
    ATGAGATCTCGTGGCTGATGGACGTGCCCGTTTCCCACGCTCGCAGTGCAGCCTCAGCACCAGAAAAGACACTTGTGGCA
    CTCACTCGCAGTCAGCTGCCGTTCTAGCACTAGTTTAGTTTTAGTTTCCAGCAACAAAATCACACGCGGCAATTCCAACA
    AATGTGCGTCAAAATCCGTGTTTAAATCGCAAGCACCACGCAAGCAAGCATCTTTTAAAAATATGTGAAAACTTCAAAGA
    TTTAAGGGTGAATACTCCAACAACGCACAACCTCACCCGAAAAAAATCCGGCTACAACAACTACCTGACTTCATCAACTG
    GCAATTTGCAATAGACTCATTGGCATTTAGCAGACCACAGACACAAAAACCCAACCCATTCGCCCAACGAAACCATTTTT
    CCGCAGAATTTCCCCCAAAGAAAGCTAAACGAGTCGCTTATAAGAAATTACTCAGCAACCAGCGGCTAGCGACGCAATGC
    AATCATCGACCGATGCGGGCAATGGTGGACCAAGAAAACACACGCAGAGCACAGCCCCCCAGAAGCAGTCGGAGATTAGC
    GAGACCACCTCCTTCACCGTAAACGCAAACACCACCACCAACAGCCAGCAGCAACAGATTCCCGGCGGACCCGCCAGCAA
    TACGCCCAGCAAAAATCCCTTCAAGCAGCAGTTGGACAGCAATCAACAGAATGGCAATATGGAGCCGGATTGCGGCATCA
    TGGGCGTCGGCAAGGAGCCACCGGTACCGCCGCCGCCCACCTACCAGTCGCAGACCTACGCAGGACGACAGGCTCCGCCG
    CCAGCGGATCAGTACCGCGAGGAGGATCCACGCGCTGCCGGGTCCTGGGCCGCCGCCAAATCCTGGATGGTCAGCTGGCG
    GGGATCCAATCGCCTGGTGCTCGTCATCGTGGCCATAGCCCTGCTCCTCGACAACATGCTGCTGACCACAGTGGTGCCCA
    TCATACCCGAGTTCCTGTACGACATACGACATCCGGATGCGCCGCTCGACAGCTTTCCACGCACACCTTTAACGTCCAAC
    GTTCCGCCGCCACCGACGCCGTGTCCATGCAACAAGGATGGCAGCGAGGCGGCTCCGCTCGAGATCTCCACGATTAGTCC
    GGAGGAGAACGAGACCTATTACCGGGAACTGGAGGAGCGGCACAACGAGCTGGTGGGCGAGACCGTCGAGGTGGGACTTC
    TATTTGCCTCCAAGGCGTTTGTCCAGCTGCTGGTTAACCCAATTGTTGGACCCCTGACTCACAGGATTGGCTATAGTATT
    CCCATGTTCGCTGGCTTTGTGATAATGTTCCTCTCAACGATAATTTTCGCTTTTGGACGATCTTACCTGGTACTGTTCGT
    GGCGAGGGCACTGCAGGGCATTGGATCATCCTGCTCCTCGGTTTCCGGAATGGGCATGCTGGCAGATCGATTTACGGACG
    ACAAGGAGCGTGGAAATGCCATGGGCATAGCACTGGGAGGATTGGCTTTGGGCGTGCTCATCGGTCCACCATTCGGTGGC
    GTGATGTACGAGTTTGTGGGCAAGTCGGCTCCATTCCTGATCCTGGCTGCCCTGGCCTTGGGCGATGGCCTGCTACAGTT
    GTTCATGCTGCAGCCATCGATCCAGAAGGCCGAAACGGAACCGCCCTCGCTGAAGAGCCTCATCAGTGATCCCTACATCC
    TGATTGCTGCTGGTGCCATCACGTTCGCCAATATGGGCATTGCCATGCTGGAACCATCGCTACCGCTGTGGATGGTGGAC
    AACATGGGCGCCACTCGTTGGGAGCAGGGCGTGGCCTTCCTGCCCGCCTCCATTAGCTACCTGATTGGCACCAATCTCTT
    CGGACCGCTGGGACACAAAATTGGACGATGGTTTGCCGCGTGCTTGGGATTGATTATCATCGGGGGATGCTTGATATTTA
    TACCCATGGCCACTTCGATCACTCACCTGATCATCCCGAATGCAGGACTTGGCTTTGCCATTGGAATGGTGGACTCGTCG
    ATGATGCCGGAACTGGGCTATCTGGTGGACATCCGACACTCGGCGGTCTACGGCAGCGTTTACGCCCTGGGTGATGTGGC
    CTTCTGTGTTGGCTTCGCCGTGGGTCCCGCCTTATCTGGATCGCTGGTGAAGAGCATCGGCTTCGAGTGGATGTTGTTTG
    GAATTGCCATACTCTGCTTTATGTATGCTCCATTGCTGACGCTGCTCAAGAATCCGCCGACCAGCGACGAGAAGAAGTCT
    TTGATCTATGGACGCGATCGGGCTCAGGTACGTTATGTAACCTATCAAAACTACGAGGAAGACGAATAAGCAAACGATTT
    AACTACAACGCAATGTTGCCAAAAGTGCAACCAAAAATCAAAAAAAAAAAAAACGGGTAATAAAATCAAG
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0091492
    2446
    FBtr0091491
    7325
    FBtr0310062
    7141
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0090963
    610
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0090962
    646
    FBpp0090961
    610
    FBpp0301763
    610
    Comments

    Transcript terminates at site supported by polyadenylated cDNA.

    Encodes Vmat protein isoform A (FBrf0187873).

    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (2)
    Reported As
    Symbol Synonym
    CG33528-RC
    Vmat-RC
    Secondary FlyBase IDs
      References (2)