Open Close
General Information
Symbol
Dmel\CG33791-RB
Species
D. melanogaster
Annotation Symbol
CG33791-RB
FlyBase ID
FBtr0091793
Feature type
Associated gene
Evidence Rank
Length (nt)
5663
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 113 )
Sequence
CAAAATTGACAGTTTTATTAAAAATAGATTAGATGCAATAGAATTATTTTTTGGACCGTAAAGTGCAAAATTTTCATATG
ATCTGTGTCAAAAGAATGCCGTGGAGCAATGTTCGCATATTTCTGAAGCTCGCTTCCCAGCGATGCCAGCTCCTAAGTGT
GGGCTCCATCCAAGAGGCGTCTGCAGGACACCGATCGGGCTCCTTCGAATCGGATGCCCTGTCGAGCACTTCGAATGCCA
GGCACATGGAGTGCCTGTTCGCCAAGTGGCTGGGGGACACTAGCTCGGTCAATGGAACCTGGCAGAATTTCTTCAAGGGA
ATGGTAGAGAAACAAATAGACTCGCAACCGCCTCGGAATAAAGAAGCAGAAGGAGATGTTCTTCCCTCGATAGGAACCAC
AACGCCAACAGATGCAGCGATTGGGGCTCCAGTTTTGGGAAGGAGAAAAGCAGTCTCTTCTTCGGCACAGCAGAGTCCTT
TGGACACTTCGGAAGCGGACTTCAACAGTTGCGTGGCTCAGTCTCAAAAGCATGATATTGGAGTGCTTTCACACTCAACG
GATATCAGAACTTCTGGCATATACGACAAACAGAAACTGCCCACATTGCCCAAAGATGGCATTCTGAAAGGCTGTTCAAT
AAACGGATCAAATATAGCCAGTGAAGCTCATTCATCGATTTTATTGGGGAATGAAGTGGCACACAACATTTCCAAAAACT
TGACCAGAAAAATGTCGCAAAAAAATACTCCAGACAAGCCAGAAAAACCACATAAGCATGAAGAAATCTTGACGGGTTCC
AGAAGAACCGGAAACTCGCGCAACAACTTTCAAAAGAAATTCGGCTCATTCGAAATTTTTATGAAATTCTGGAAACACGC
ACATGCATTGGATAAGTATAAGCGGCATATTGGTCCAGTAATGGTTGTGAAGAAGCGTTCAAAAACCAATTCAAAGCCAA
TTAACGTCATGTACTTCAAAAATTATTACGAAAAGGGTTTACGTCTAAGGAAGGAAAGGTTGAATAAAATCAAAAGCAAT
AAGAAAATTAAAATGCCTTCAAAAAGCCCTAAGGAGTCCGTAGCTAAAGAAATCATTGAAAATGCCAATATACCACAATC
TCACCCAGAAACAAAGAAATCCACATATGTTTCAAAACACAAGAGCGATACATATGCGACCCTTGAGGAACTGATCAACG
ATATTGATGACATCGCCATAAATGAGAAGTTGTCTGAATCGATTGAGCCAGTGAAAACCAAGAAAGACAGTAAAACACCG
AAGCTGTTGGAGAACACTCCCAAAAAGAAGCCAAAGAATTTCAAAACGGCACTTAGGGTTTTCAAGCCCGAAGAGAAGGT
TATCCCAAAATCGGATAATATGCCGAGCTCAAATATCAAGCCCAATCCCGTTTCCAAGTTGGACAAATCCAAATTAAGTA
AGCCGAAGACTGAAAAATACATTCCTTTGAGGGTTTTCAATACACCAAAAGAAGACGAAGACAAGTCATGGATATATTGG
GATGAGTTGGCAGTGAAAAGCCTGCGAAAACCAACTCAAGACTAGCACTTCATCCTCAGAAACCCAAGAAGGAAGTTGGG
CAGCCTCTTCATCCTTTGAACTGAAACTAACCTAACGAATCTCAGCACGTCTTGCCACAAGTGATTCCTACTATGAGCTG
ATCTCACAACTTTCTCAGCCTTCGAACCCTAAGCACCAAATTCAAAATTTAACAGGTATTTCGGTAGTCCCTTCTAGAAC
ATGAACCAATGTCGTCTGAGGAGCCTGGCGCGGATCAGGAGGAGCCTGACACTGGGTTTGCGGGGAACTGACCAACACGT
CCTCGCCCGTCAAGCCCTCCGCACCATTCAAACGACCTCACAGCGGCGAGGTGTCCATGATCTGGACTCCTTCGCCAATG
GATGCAGTGCCGCCTACATCGAGGGACTCTACAACAAGTGGAAGCGCAATCCCAGTTCCGTAGATGAGTCCTGGAACGAG
CTCTTCAGCAGCAACGATTGGTCCAGCCCCAAGAGAAGTCCTCTTCAGGTTTCGCACTCCCGGAAGTACAGACGTCCTCC
GGTTGAAAGGATAGCTGTGAAGGCTCGGTCGGGCGAAAGGACGGCTTCCGGTGGCGCATCTGCAGCTCCAGCCGCACCTC
CCAGCGACTGGAAGAACATTGATGACCACCACGTGATCCAGGCCATCATCCGTGCCTATCAATCGCGCGGTCACTTGGCC
GCCGATCTGGATCCCTTGGGTATTGTTGGTCCGAAGAAGCGTACGTCGGTGGATGGCACCCAGCGACATGCCGCCAGGGA
GGTGCTCCGCCAGCACTTCTCCTATATATTTAATGACCTCAATACCGTGTTCAAGTTGCCCTCATCCACAATGATAGGCG
GTGATCAGGAATTTCTGTCACTAAAAGAGATCCTGGATCGCTTGGAGCGCATCTATTGCGGCCACATTGGAGTGGAGTAC
ATGCAGATCACGTCGTTGACAAAGACCAACTGGCTTCGCGACCGTTTCGAGAAGCCTGGAGGCCTGGACTTGACCAAGGA
GGAAAAGAAGCTCATCCTAGAGCGTCTCACTCGCTCGACGGGATTCGAAAACTTCCTGGCGAAAAAGTTCTCGTCGGAGA
AGCGTTTCGGACTGGAGGGATGCGACATTATGATACCCGCTATAAAGGAGGTGGTTGACCGGGCCACGGACCATGGCGTG
GAGTCAATTTTAATAGGAATGGCGCATCGAGGGCGCCTCAATGTCCTCGCCAACATCTGTCGCAAGCCCATTTCGGACAT
CCTGTCTCAGTTCCACGGCTTGCAGGCCACCGATTCCGGATCTGGCGACGTTAAGTACCATCTGGGCGTGTTTCAAGAGC
GGCTCAACCGACAGACAAACCGCATGGTGCGCATCACCGTGGTGGCGAATCCCTCTCACTTGGAGCACGTCAACCCGGTG
CTCCTGGGTAAGGCCCGAGCGGAGATGTTCCAACGGGGCGACACATGTGGCAGCACGGTGATGCCCATCATTATCCACGG
AGATGCCTCCTTTTCCGGTCAGGGCGTGGTCTACGAATCAATGCATCTGTCCGACTTGCCCAACTACACCACCTACGGCA
CCATTCACATTGTGTCCAACAACCAGGTGGGCTTCACGACAGATCCGCGTTTCTCCCGCTCCTCGCGCTACTGCACGGAC
GTTGCCAAGGTGGTGAATGCTCCGATACTGCACGTGAATGCGGACGATCCGGAGGCGTGCATCCAGTGCGCTCGCATTGC
CATCGACTATCGGACACGATTCAAGAAGGATGTGGTCATCGACATAGTTGGCTACCGACGCAACGGGCACAATGAGGCGG
ATGAACCCATGTTCACCCAGCCGCTGATGTACCAGCGCATAAAAAAACTGAAGCCATGCCTCCAGCTCTACGCCGATAAG
TTGATCAAGGAGGGAGTCGTCACGGATAGCGAGTTCAAGGCAATGGTGTCAAGCTACGAAAAGATCTGCGAGGACGCTTG
GGCCAAGTCCAAGACCATCAAGACCATAAAGTATTCCTCTTGGATCGACTCTCCCTGGCCAGGATTCTTCGAGGGTCGCG
ATCGCCTGAAACTGTGCCCCACTGGCATCAGCACGGACACCCTGAAGACGATTGGCAACATGTTCTCGACTCCTCCGCCG
CCGGAGCACAAGTTCGAGACACACAAGGGCATCCTTCGCATACTGGCCCAGCGCACGCAGATGGTGCAGGACAAAGTGGC
TGACTGGTCGCTGGGCGAGGCCTTCGCCTTCGGCTCGCTCCTTAAGGAGGGCATCCACGTTCGACTATCCGGCCAAGATG
TGGAGCGCGGCACCTTTTCGCACCGGCACCACGTCCTGCACCACCAGTCGGAGGACAAGGTGGTGTACAACTCACTGGAC
CACCTCTATCCCGACCAGGCGCCCTACTCCGTCTCCAACAGCTCCCTGTCGGAGTGTGCGGTCCTTGGCTTCGAGCACGG
CTACTCCATGGCCAGTCCCAATGCTCTGGTCATGTGGGAAGGCCAGTTTGGGGACTTCTGCAACACGGCGCAGTGCATCA
TCGACACGTTCATAGCCAGCGGCGAAACCAAGTGGGTGCGCCAGTCCGGAGTCGTCATGTTGCTGCCACACAGCATGGAG
GGCATGGGCCCGGAGCACTCTTCCGGCCGCATTGAGCGCTTCCTGCAGATGAGCGACGACGATCCGGACGTCTATCCGGA
TACCTGCGACGCTGACTTTGTGGCTCGCCAGCTAATGAATGTCAACTGGATTGTGACGAATCTCTCCACGCCCGCAAATC
TGTTCCACTGCCTGCGCCGCCAGGTGAAGATGGGCTTCCGGAAGCCGCTGATTAACTTCTCGCCCAAGTCACTGCTCCGC
CATCCGCTGGCGCGAAGTCCCTTCAAGGACTTCAACGAGTGCAGTTGCTTCCAGCGCATCATTCCCGACAAAGGACCCGC
CGGCAAGCAGCCCGACTGCGTCCAGAAGCTGGTCTTCTGCTCGGGAAAGGTCTACTACGATCTCGTCAAGGAGCGCGACG
ATCACGAGCAGGTGGAGACGGTGGCCCTGGTGAGGGTGGAACAGGTGAGACGCCTCCCAACGCGACACCTCTTCTTGTTC
ATGATAACCATGATTGGGCGCATCCTCCAGCTCTGTCCCTTCCCCTACGACCTGATCAGCCAGCAGCTGGAGCTGTATCC
CAAGGCGGAGCTGCTGTGGGCCCAGGAGGAGCACAAGAACATGGGCGCCTGGTCTTACGTGCAGCCGCGTTTCGACACGG
CGCTCCTCAAGAACGAAAACGAATCGCGCTGCGTGTCCTATCACGGACGACCGCCCAGCGCCTCGCCAGCGACGGGCAAC
AAGGTGCAGCACTACAACGAGTACAAGGCCCTGATCACAAGCATCTTCGGAGAGCTGACGCCGGAGAACAAGAAGCGAAT
CGAGGATCGGATCAAGAAGCAGCAGGCAAAGGCCAAGGCGGATGCGCAATCGAAACCCAGTACTAAGCCACCAGCCGCTC
CACCAAAGGGCGGTTCGTCGCCGCCACCAGGTAAGGGCGAATCTGGAGGAAAAAAGAGATCCGATTCGTCTCCATCTGCG
TCTATAGCTCCTACAGGTCCAGCACCCCGTAAGCCACTGATCAGTCTGCCAAGTAGACCTCCAAGGGGTGGAAAGCAGCG
GTCCGGCTCGGCTCCAGCTCCTAATCTGGTTGATGAAGATTCAGCTGCTCGAAATAGGGAACCAGATGCTTCTGCATATG
ATGGCGCATCACCGTCAGCTTGGAAGAGATCGGGCTCTGCTCCAGCACCGAGTGTAGTTCCCAGGGCATCGGCCTCCCGC
AGTCCGTCTAGAAAGTCACCTTCACCCTCTCACGACGGCATATCTCCTTCTACAAGACAAGAATCCTTAAGCAAAAAGAA
ATCAGGGTCGGCTCCAGCTCCGACGCCAACTTCTCGTGGACCATTCCGGACTGCGCCCTCCAATACAGAATTCATAAAGC
GCAGACCTGCTAAAGATTACGGCAGTAGAAATGAAACCCAAAGCACTCCCGGGGAGTCGGAACTGGACCCAACAAAACCA
CAGCCCTAGTTTGAATCCTCCTTTGTAAGTCCACCAATAAAGATAGGTAATAGTTACAGAAAG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0091792
3886
FBtr0091794
5531
FBtr0091795
4018
FBtr0300891
3895
FBtr0300892
5540
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0072631
1282
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0072635
1238
FBpp0072633
1238
FBpp0072636
1282
FBpp0290113
1241
FBpp0290114
1241
Comments

Dicistronic transcript; alternative monocistronic transcript(s) exist.

Transcript terminates at site supported by polyadenylated cDNA.

transcript_exception: dicistronic_mRNA

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG32316-RB
CG33791-RB
Secondary FlyBase IDs
    References (2)