Open Close
General Information
Symbol
Dmel\His4:CG33905-RA
Species
D. melanogaster
Annotation Symbol
CG33905-RA
FlyBase ID
FBtr0091909
Feature type
Associated gene
Evidence Rank
Length (nt)
413
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 17 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTAGTTCTTTAGTGACTTTCGTGCTGTGCGTGTATAATAGTATAGAACAGTGAAAAATGACTGGTCGTGGTAAAGGAGGC
        AAAGGCTTGGGAAAGGGTGGCGCCAAGCGTCATCGCAAAGTGCTGCGTGATAACATCCAAGGTATCACGAAGCCTGCTAT
        CCGCCGTTTGGCCCGTCGAGGCGGTGTGAAGCGCATATCTGGACTCATATACGAGGAAACGCGTGGCGTTCTGAAGGTTT
        TCTTGGAGAACGTAATTCGTGATGCCGTGACCTACACGGAACACGCCAAGAGGAAGACAGTTACAGCCATGGATGTTGTG
        TACGCTCTGAAGAGGCAAGGCCGCACCCTCTACGGATTTGGCGGTTAAAAAGTGTACATCCTGTGTACCCCTATTAAGCA
        ATCGGTCCTTTTC
        
        Other Products of this Gene
        Other Transcripts
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0091150
        103
        Derived from OTHER transcripts
        Comments
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG33905-RA
        His4:CG33905-RA
        Secondary FlyBase IDs
          References (2)