Open Close
General Information
Symbol
Dmel\CtBP-RE
Species
D. melanogaster
Annotation Symbol
CG7583-RE
FlyBase ID
FBtr0100161
Feature type
Associated gene
Evidence Rank
Length (nt)
2612
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 231 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ACTGTTCGCATAGCGTCATTGCTGTACTAAAACCTAAAAATCCGCCGTGTTCGTATTCCGCCATTTTGAAAGCTGCGAGT
      GGAATTTGGACGCGTTGCTGGATTCTCGATTTCAATATGAAGCGCCAAAAATGATTGCAGCGTTTGCATCGTAGTCTTGA
      AAAGGTTTTTTTCATTGATTTAATTAGAGCCACTGAAAGCGGTTGGCCAGCCAGAAAAACGATAAAAGGGATTCCATACC
      AGTCTGCGCCCAGCGCCCCCCGAAACGCGGTAGTACAGAAATATCAAAAAAAGAACCACAGCCGGAAAAGGGCAAAAGTT
      TTATTCCGACGACGACGAAGAGCAGAGGACAGCAGCAGACAGATTGAAAAACAGCGAAATGGACAAAAATCTGATGATGC
      CGAAGCGTTCGCGCATCGATGTCAAGGGCAACTTTGCCAACGGACCGCTGCAAGCACGCCCACTGGTGGCCCTACTCGAT
      GGACGCGACTGCTCCATCGAGATGCCCATCCTAAAGGATGTGGCCACGGTGGCCTTTTGCGATGCACAAAGCACCTCCGA
      AATACACGAGAAGGTCCTCAACGAGGCAGTGGGAGCTCTGATGTGGCACACCATCATCTTGACAAAGGAGGATCTTGAGA
      AGTTCAAAGCTTTACGCATTATCGTGCGCATCGGCAGCGGCACAGACAACATTGATGTAAAGGCGGCGGGCGAACTGGGC
      ATCGCCGTGTGCAACGTTCCCGGCTACGGAGTCGAGGAGGTGGCGGACACGACGATGTGCCTCATCCTCAACCTCTACCG
      GCGGACATACTGGCTAGCGAACATGGTGCGCGAGGGCAAGAAGTTCACCGGACCCGAGCAAGTGCGGGAGGCTGCGCATG
      GCTGTGCACGCATCCGCGGCGACACCTTGGGTCTGGTGGGACTGGGCCGCATTGGTAGCGCCGTGGCCCTGCGGGCTAAG
      GCGTTCGGCTTCAACGTCATCTTCTACGATCCCTACCTGCCCGATGGCATCGACAAGTCGCTGGGCCTAACTCGCGTCTA
      CACGCTGCAGGACCTGCTTTTCCAGTCCGATTGCGTCTCACTGCATTGCACGCTCAACGAGCACAACCATCATTTAATCA
      ATGAATTCACAATTAAACAGATGCGACCTGGTGCATTTCTGGTGAACACCGCACGCGGCGGTCTGGTCGATGACGAGACC
      CTGGCGTTGGCGCTGAAGCAGGGAAGGATAAGAGCTGCCGCCCTGGACGTTCACGAAAACGAACCTTACAATGTATTTCA
      AGGCGCACTGAAGGATGCCCCAAATCTGATTTGCACACCGCACGCCGCCTTCTTCAGCGACGCGTCCGCAACGGAGCTGC
      GCGAAATGGCAGCCACCGAGATCCGGCGGGCGATCGTCGGCAATATTCCAGACGTGCTGAGGAATTGCGTCAACAAGGAG
      TACTTCATGCGCACGCCGCCTGCCGCTGCCGCCGGGGGCGTGGCGGCGGCTGTTTATCCCGAAGGCGCACTGCATCACCG
      GGCACACAGCACCACACCGCACGATGGCCCCCACAGTACAACCAACCTGGGCAGCACCGTAGGAGGCGGTCCGACGACAG
      TCGCTCAAGCTGCCGCTGCAGCTGTGGCCGCTGCAGCAGCCGCCGCCCTCCTGCCGTCGCCGGTTCCGTCGCACTTGTCG
      CCCCAGGTCGGCGGATTGCCGCTTGGAATTGTGAGTAGCCAATCGCCCCTGAGTGCGCCCGACCCTAATAATCATCTGTC
      ATCGAGCATAAAAACGGAGGTGAAGGCCGAGTCAACGGAGGCGCCGTAGGCATCTGCTGTCCAACTGGCTGCACCTGAGA
      GCTGAAGAGCTGGAGTTGACGATGACAACGGGCAGTGGCGCAATGGAGTCCAGCACACAACAACTGGCAAAAAGAAAATC
      GAGGAGGAGGAGGAGGAGGAGTAGGCGGCGTAGTACGAGCATTGTGGAGCAGTAGACCCCATGGAATTCGGTCCCCAAGG
      ATAAAACTTAACGAGAAACAAAACAAAACAAAACCCAGCAGTAGTCATCCGTCGAATGTGTGGAGTCCTCCCCTATATCC
      GTGCCGTTTGTTCTTTTGTTCCGGTTGAGAAACGGATTGCTTGCGCGCCTGTGCCAGCGCTTGATTTGAATTTTTCCAAG
      TTTCTATGTTTTAATTTAAAATACAATACATATTTGCATTACCAACTCCCGAAAGAAAGAAATCAACAACAAAATAAAAA
      CAAAATACAACATTAAAAACAACGCAGGAAAACGAGGAGTATGATGATTATGATGATCCCCACACACAACACGCCTCAAA
      ATTTACTACGTATTTAGACTTTAATTTGTAACTATTTAGAATTTTACAGTTACAACTTAAGATTTTTATTTGTATTGCAG
      CCAATTGTAAGTGAAAATATGTTACTACATATAAGCGCAAAAACAAATGCAAATGTTGGAAAATTTTAATTACGAGAAAC
      AAACAAACAATTATGGCATACAAACAAAAAACAAAACAAAACACTAGAAACAAAACAAAAGCAACACAAGAGAGACGTTT
      AGTGCTAAGATACGTTTAAAGTACATAATAAAAGAAAAACGAAAGTAAAGCG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0082699
      3959
      FBtr0082701
      1719
      FBtr0082700
      4383
      FBtr0082702
      3946
      FBtr0334513
      4556
      FBtr0334514
      2590
      FBtr0334515
      2627
      FBtr0334516
      2382
      FBtr0334517
      2612
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0099514
      476
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0082167
      386
      FBpp0082169
      386
      FBpp0082168
      386
      FBpp0082170
      386
      FBpp0306580
      383
      FBpp0306581
      473
      FBpp0306582
      481
      FBpp0306583
      379
      FBpp0306584
      476
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      Isoform A
      Secondary FlyBase IDs
        References (2)